Search This Blog

Monday, September 4, 2023

Haplogroup Q-M242

From Wikipedia, the free encyclopedia
https://en.wikipedia.org/wiki/Haplogroup_Q-M242
 
Haplogroup Q
Frequency distribution of haplogroup Q-M242.
Possible time of origin17,200 to 31,700 years ago (approximately 24,500 years BP)
Possible place of originCentral Asia, South Central Siberia
AncestorP1-M45
DescendantsQ1 (L232/S432)
Defining mutationsM242 rs8179021
Highest frequenciesKets 93.8%, South American Indians 92%, Turkmens from Karakalpakstan (mainly Yomut) 73%, Selkups 66.4%., Altaians 63.6%., Tuvans 62.5%., Chelkans 60.0%., Greenlandic Inuit 54%, Tubalar 41%, Siberian Tatars (Ishtyak-Tokuz Tatars) 38%, Inuit, the indigenous peoples of the Americas, Akha people of northern Thailand, Mon-Khmer people and some tribes of Assam

Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.

Q-M242 is the predominant Y-DNA haplogroup among Native Americans and several peoples of Central Asia and Northern Siberia.

Origins

Haplogroup Q-M242 is one of the two branches of P1-M45, the other being R-M207. P1, as well as R* and Q* were observed among Ancient North Eurasians, a Paleolithic Siberian population.

Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia), approximately 17,000 to 31,700 years ago. However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.

Technical specification of mutation

The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003. The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The 2015 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

The Genomic Research Center draft tree

Below is a 2012 tree by Thomas Krahn of the Genomic Research Center. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

The Y Chromosome Consortium tree

This is the 2008 tree produced by the Y Chromosome Consortium (YCC). Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

Phylogenetic variants

The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2. The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.

Distribution

Americas

Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait. These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Regardless, Q-M242 came to dominate the paternal lineages in the Americas.

North America

In the indigenous people of North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache, 87% in SC Apache, and about 80% in North American Eskimo (Inuit, Yupik)–Aleut populations. (Q-M3 occupies 46% among Q in North America)

On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he turned out to be genetically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans. Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.

Q-M242 is estimated to occupy 3.1% of the whole US population in 2010:

Ethnicity Percentage of USA population † Haplogroup Q frequency
White people 63.7% Q-P36* 0.6% & Q-M3 0.1%
Hispanic 16.3% Q-P36* 3.8% & Q-M3 7.9%
Black 12.6% Q-P36* (xM3) 0.2%
Asian 4.8% ~0%
Native American ‡ 0.9% Q-P36* 31.2% & Q-M3 26.9%
Sources :

† According to the US National Population Census data (2010)

‡ Mainland and Alaska, not including the Pacific islands

Mesoamerica & South America

Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America.

The frequencies of Q among the whole male population of each country reach as follows:

Asia

Q-M242 originated in Asia (Altai region), and is widely distributed across it. Q-M242 is found in Russia, Siberia (Kets, Selkups, Siberian Yupik people, Nivkhs, Chukchi people, Yukaghirs, Tuvans, Altai people, Koryaks, etc.), Mongolia, China, Uyghurs, Tibet, Korea, Japan, Indonesia, Vietnam, Thailand, India, Pakistan, Afghanistan, Iran, Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on. (For details, see below.)

North Asia

In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012), Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples. In another study, the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.

Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 14%~38.0% (41/108) of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva show the frequency at ≤22.2% (8/36 P(xR1))~38.5% (10/26, all Q-M346(xM3)). So, the average frequency of Q-M242 among Tuvans-Todjins in Tuva Republic is about 25%. Haplogroup Q-M242 has been found in 5.9% (3/51) of a sample of Tuvans from the village of Kanasi, 9.8% (5/51) of a sample of Tuvans from the village of Hemu, and 62.5% (30/48) of a sample of Tuvans from the village of Baihaba in northern Xinjiang near the international border with Altai Republic.

In Siberian Tatars, the Ishtyako-Tokuz sub-group of Tobol-Irtysh group has a frequency of Q-M242 at 38%.

The highest frequencies of Q-M242 in Eurasia are witnessed in Kets (central Siberia) at 93.8% (45/48) and in Selkups (north Siberia) at 66.4% (87/131). Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains (Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the Yeniseian language family which has been linked by some scholars to the Native American Na-Dené languages and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank, E. Vajda, A. Vovin, etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), Khakassians (6.3%, Q-M346), Kalmyks (3.4%, Q-M25, Q-M346) and Khanty, and so on.

In far eastern Siberia, Q-M242 is found in 35.3% of Nivkhs (Gilyaks) in the lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Yupik people in Chukotka (Chukchi Peninsula). It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka. It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.

East Asia

In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4~3.1% of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25~1.25%), Q1a1b-M25 (0.25~0.63%), Q1b-M378. In another study, Q is found in 4% of Mongols. Karafet et al. (2018) found Q-L54(xM3) in 2.7% (2/75) and Q-M25 in another 2.7% (2/75) for a total of 5.3% (4/75) haplogroup Q Y-DNA in a sample of Khalkha Mongols from Ulaanbaatar, Mongolia. Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.

However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China (the provinces of which the capitals locate northern to Huai River-Qin Mountains line). Q-M242 ranged from 4~8% in northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China. The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China. In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China. In another study published in 2011, Hua Zhong et al. found haplogroup Q-M242 in 3.99% (34/853, including 30/853 Q-M120, 3/853 Q-M346, and 1/853 Q-M25) of a pool of samples of Han Chinese from northern China and 1.71% (15/876, including 14/876 Q-M120 and 1/876 Q-M346) of a pool of samples of Han Chinese from southern China. Q1a1-M120 is unique to East Asians. It is not found in South east Asia except with low diversity in Y-STR among southern Han Chinese indicating it spread during the Neolithic with Han Chinese culture to southern China from northern China. Q1a3*-M346 is only found among Hui and southern Han Chinese in South East Asia in southern China but not found in non-Han indigenous peoples at all. It came from northern China (north east Asia) with the Han. Only Native Americans have Q1a3a-M3, which is a descendant haplogroup of Q1a3*-M346. The Americas was populated by migrants from Central Asia in prehistoric times. Q1a1 is attested in over 3,000 year old Han Chinese ancestral remains in the Shang and Zhou dynasties from the Hengbei archeological site. Modern northern Han Chinese Y haplogroups and mtdna match those of ancient northern Han Chinese ancestors 3,000 years ago from the Hengbei archeological site. 89 ancient samples were taken. Y haplogroups O3a, O3a3, M, O2a, Q1a1, and O* were all found in Hengbei samples.

Q-M242 has been found with notable frequency in some samples of Uyghurs: 15.38% (22/143, including 6/143 Q-M378, 5/143 Q-P36.2*, 4/143 Q-M120, 4/143 Q-M346, 1/143 Q-M25) of a sample of Uyghurs from the Turpan area (吐鲁番地区), 7.9% (6/76, including 2/76 Q1b1-L215/Page82/S325, 1/76 Q1a2-M346*, 1/76 Q1a1a1-M120, 1/76 Q1a2a1c-L330*, 1/76 Q1a2a1c1-L332) of a sample of Dolan Uyghurs (刀郎人) from Horiqol Township of Awat County, and 7.74% (37/478, including 24/478 Q-M346, 7/478 Q-P36.2*, 5/478 Q-M120) of a sample of Uyghurs from the Hotan area (和田地区). However, other studies have found haplogroup Q in much smaller percentages of Uyghur samples: 3.0% (2/67) Q-P36 Uygur, 1.6% (1/64) Q-M120 Lop Uyghur (罗布人). Haplogroup Q was not observed in a sample of 39 Keriyan Uyghurs (克里雅人) from the village of Darya Boyi, located on the Keriya River deep in the Taklamakan Desert.

Haplogroup Q was observed in 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet in one study and in 1.23% (29/2354) of males in Tibet in another study, but this haplogroup was not observed in a sample of males from Tibet (n=105) in a third study.

It is found in about 1.9% of South Koreans, showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It has been found in about 0.3% of Japanese (with known examples from Shizuoka and Saitama) and in 0.3%~1.2% of Taiwanese.

Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.

Southeast Asia

Haplogroup Q shows low frequencies in Southeast Asia. In a study, the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries.

In the case of Vietnam, the frequency is 7.1% in one study of a sample of Vietnamese reported to be from southern Vietnam and 4.3% in a sample of Kinh people from Ho Chi Minh City in southern Vietnam, but 0% or under 1% in other studies in which samples have been collected in Hanoi in northern Vietnam. So, it is hard to define average frequencies. However, Macholdt et al. (2020) have tested a sample of fifty Kinh people from northern Vietnam (all but one of whom are from the Red River Delta region, and 42 of whom are from Hanoi) and found that two of them (4%) belong to Q-M120.

Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in 18.8% in Ayeyarwady (2/11) and 7.1% Bago (1/14) regions in southwest Myanmar. And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand.

Central Asia

In Central Asia, the southern regions show higher frequencies of Q than the northern ones.

In the northern regions, Q-M242 is found in about 2%~6% (average 4%) of Kazakhs. A study published in 2017 found haplogroup Q Y-DNA in 3.17% (41/1294) of a large pool of samples of Kazakh tribes; however, haplogroup Q was concentrated in the members of the Qangly tribe (27/40 = 67.5%), and it was much less common among the other tribes. The Qangly tribe is related at least in name to the earlier Kankalis and probably also the Kangar union. Haplogroup Q is found in about 2% of Kyrgyz people.

In the southern regions, Q-M242 is found in 5%~6% of Tajiks (Tajikistan). Karafet et al. 2001 found P-DYS257(xQ1b1a1a-M3, R-UTY2), which should be roughly equivalent to haplogroup Q-M242(xM3), in 4/54 = 7.4% of a sample of Uzbeks, apparently sampled in Uzbekistan. Wells et al. 2001 found P-M45(xM120, M124, M3, M173), which should be roughly equivalent to a mix of Q-M242(xM120, M3) and R2-M479(xR2a-M124), in 20/366 = 5.5% of a pool of samples of Uzbeks from seven different regions of Uzbekistan. Di Cristofaro et al. 2013 found Q-M242 in 11/127 = 8.7% of a pool of samples of Uzbeks from three different provinces of Afghanistan, including 5/94 Q-M242(xM120, M25, M346, M378), 4/94 Q-M346, and 1/94 Q-M25 (10/94 = 10.6% Q-M242 total) in a sample of Uzbeks from Jawzjan Province, whose northern border abuts the southeastern corner of Turkmenistan, and 1/28 Q-M242(xM120, M25, M346, M378) in a sample of Uzbeks from Sar-e Pol Province. Wells et al. (2001) found P-M45(xM120, M124, M3, M173) in 10.0% (3/30) of a sample of Turkmens from Turkmenistan, whereas Karafet et al. (2018) found Q-M25 in 50.0% (22/44) of another sample of Turkmens from Turkmenistan, so the frequency of haplogroup Q in that country is not yet clear. However, Grugni et al. (2012) found Q-M242 in 42.6% (29/68) of a sample of Turkmens from Golestan, Iran, and Di Cristofaro et al. (2013) found Q-M25 in 31.1% (23/74) and Q-M346 in 2.7% (2/74) for a total of 33.8% (25/74) Q-M242 in a sample of Turkmens from Jawzjan, Afghanistan, so the frequency of Q-M242 may reach about 40% in Turkmens of Afghanistan and Iran who live in the areas adjacent to Turkmenistan.

Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In another study (Cristofaro 2013) with a larger sampling, the frequency of Q rises to 8.9% (45/507). Haplogroup Q occurs at a frequency of 8% (11/136) in Afghan Pashtuns and 3% (5/142) in Afghan Tajiks. In this study(Cristofaro 2013), Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346).

Southwest Asia

Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.

Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan (Persian people), 6.8% in Khorasan (Persian people), 6% in Lorestan (Luristan, Lurs), 4.9% in Azarbaijan Gharbi (5.1% of Assyrians and 4.8% of Azeris), 4.5% in Fars (Persian people), and so on. Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.

In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians.

Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.

Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36) Syrians and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.

Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q. In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.

South Asia

In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)~3.4% (6/176).

In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples. (For more information, see Y-DNA haplogroups in populations of South Asia)

In a regional study in Gujarat (Western India), Q-M242 was found at its highest 12% (3/25) among Nana Chaudharis while the overall percentage in Gujarat was found to be 2.8% (8/284). In another study, 2.6% of Tharus in Chitwan district and 6.1% (3/49) of Hindus in New Delhi, the capital of India were found to be Q-M242 positive.

In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh. In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.

1.2% of Nepalese people in Kathmandu, the capital of Nepal and 3.2% of people from Tibet are in Q-M242.

3.3% of Sri Lankans are also in Q-M242.

Europe

Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.

Central- and Eastern Europe

In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians, 1.5% of Belarusians, 1.3% of Ukrainians 1.3% of Poles (Poland), 2% of Czechs, 1.5% of Slovaks, about 2.2% of Hungarians,{citation needed} 1.2% of Romanians, 0.8% of Moldovans, and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila's Huns) turned out to be P* (xR1-M173), which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.

The Caucasus region shows a frequency at 1.2% in a study, but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242. It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.

Northern Europe

In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.

In Norway, Q-M242 is found in about 2.6% (~4%) of males, with Q-L804 being more common than Q-F1161/L527. It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings). In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242. On the other hand, it is 0.2% in Finland, 4.6% in Latvia, 1.1% in Lithuania, 0.5% in Estonia.

Western Europe

In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland, and it reaches 5.1% in Lyon (Rhône-Alpes) region of France. It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia. Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).

Southern Europe

Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3% (13/91) in Hvar Islands and 6.1% (8/132) in Korčula. Also, it is about 0.6% in Italy, but it rises to 2.5% (6/236) in Sicily, where it reaches 16.7% (3/18) in Mazara del Vallo region, followed by 7.1% (2/28) in Ragusa, 3.6% in Sciacca, and 3.7% in Belvedere Marittimo.

On the other hand, according to a study (Behar 2004), 5.2% (23/441) of Ashkenazi Jewish males belong to haplogroup Q-P36. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)~5.6% (3/53) of Sephardi Jews are in haplogroup Q.

Africa

Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147), of Egyptians and in 0.6% (1/156) of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.

To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

Subclade distribution

Y-DNA Q samples from ancient sites

  • South Central Siberia (near Altai)
  • North America
  • Altai (West Mongolia)
    • Tsagaan Asga and Takhilgat Uzuur-5 Kurgan sites, westernmost Mongolian Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54 (period unknown), 1 Q-M242 (B.C. 28C), 1 C-M130 (B.C. 10C)
  • Greenland
  • China
    • Hengbei site (Peng kingdom cemetery of Western Zhou period), Jiang County, Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*
      • In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a, 1 O*
      • (cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120.
    • Pengyang County, Ningxia, 2500YBP: all 4 Q1a1-M120 (with a lot of animal bones and bronze swords and other weapons, etc.)
    • Heigouliang, Xinjiang, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades):
      • In a paper (Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at Heigouliang in Xinjiang – which is also believed to be the site of a summer palace for Xiongnu kings – which is east of the Barkol basin and near the city of Hami. The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims.
    • Xiongnu site in Barkol, Xinjiang, all 3 Q-M3
      • In L. L. Kang et al. (2013), three samples from a Xiongnu) site in Barkol, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and Native Americans, the authors suggest that the Xiongnu had connections to speakers of the Yeniseian languages. These discoveries from the above papers (Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the Huns.
    • Mongolian noble burials in the Yuan dynasty, Shuzhuanglou Site, northernmost Hebei China, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)
      • (cf) Korguz was a son of a princess of Kublai Khan (元 世祖), and was the king of the Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor, Korguz who died in 1242.) The Ongud tribe (汪古部) was a descendant of the Shatuo tribe (沙陀族) which was a tribe of Göktürks (Western Turkic Khaganate) and was prominent in the Five Dynasties and Ten Kingdoms period of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since Genghis Khan's period. About 16 princesses of the Yuan dynasty married kings of the Ongud tribe.

Cobalt bomb

From Wikipedia, the free encyclopedia

A cobalt bomb is a type of "salted bomb": a nuclear weapon designed to produce enhanced amounts of radioactive fallout, intended to contaminate a large area with radioactive material, potentially for the purpose of radiological warfare, mutual assured destruction or as doomsday devices.

History

The concept of a cobalt bomb was originally described in a radio program by physicist Leó Szilárd on February 26, 1950. His intent was not to propose that such a weapon be built, but to show that nuclear weapon technology would soon reach the point where it could end human life on Earth, a doomsday device.

The Operation Antler/Round 1 test by the British at the Tadje site in the Maralinga range in Australia on September 14, 1957, tested a bomb using cobalt pellets as a radiochemical tracer for estimating yield. This was considered a failure and the experiment was not repeated. In Russia, the triple "taiga" nuclear salvo test, as part of the preliminary March 1971 Pechora–Kama Canal project, produced relatively high amounts of cobalt-60 (60Co or Co-60) from the steel that surrounded the Taiga devices, with this fusion-generated neutron activation product being responsible for about half of the gamma dose in 2011 at the test site. The high percentage contribution is largely because the devices primarily used fusion rather than fission reactions, so the quantity of gamma-emitting caesium-137 fallout was comparatively low. Photosynthesizing vegetation exists all around the lake that was formed.

In 2015, a page from an apparent Russian nuclear torpedo design was leaked. The design was titled "Oceanic Multipurpose System Status-6", later given the official name Poseidon. The document stated the torpedo would create "wide areas of radioactive contamination, rendering them unusable for military, economic or other activity for a long time." Its payload would be "many tens of megatons in yield". Russian government newspaper Rossiiskaya Gazeta speculated that the warhead would be a cobalt bomb. It is not known whether the Status-6 is a real project, or whether it is Russian disinformation. In 2018 the Pentagon's annual Nuclear Posture Review stated Russia is developing a system called the "Status-6 Oceanic Multipurpose System". If Status-6 does exist, it is not publicly known whether the leaked 2015 design is accurate, nor whether the 2015 claim that the torpedo might be a cobalt bomb is genuine. Amongst other comments on it, Edward Moore Geist wrote a paper in which he says that "Russian decision makers would have little confidence that these areas would be in the intended locations" and Russian military experts are cited as saying that "robotic torpedoes could have other purposes, such as delivering deep-sea equipment or installing surveillance devices."

Mechanism

Decay of cobalt-60 showing the release of powerful gamma rays.

A cobalt bomb could be made by placing a quantity of ordinary cobalt metal (59Co) around a thermonuclear bomb. When the bomb explodes, the neutrons produced by the fusion reaction in the secondary stage of the thermonuclear bomb's explosion would transmute the cobalt to the radioactive cobalt-60, which would be vaporized by the explosion. The cobalt would then condense and fall back to Earth with the dust and debris from the explosion, contaminating the ground.

The deposited cobalt-60 would have a half-life of 5.27 years, decaying into 60Ni and emitting two gamma rays with energies of 1.17 and 1.33 MeV, hence the overall nuclear equation of the reaction is:

59
27
Co
+ n → 60
27
Co
60
28
Ni
+ e + gamma rays.

Nickel-60 is a stable isotope and undergoes no further decays after the transmutation is complete.

The 5.27 year half life of the 60Co is long enough to allow it to settle out before significant decay has occurred, and to render it impractical to wait in shelters for it to decay, yet short enough that intense radiation is produced. Many isotopes are more radioactive (gold-198, tantalum-182, zinc-65, sodium-24, and many more), but they would decay faster, possibly allowing some population to survive in shelters.

Fallout from cobalt bombs vs. other nuclear weapons

Fission products are more deadly than neutron-activated cobalt in the first few weeks following detonation. After one to six months, the fission products from even a large-yield thermonuclear weapon decay to levels tolerable by humans. The large-yield two-stage (a fission trigger/primary with a fusion–fission secondary) thermonuclear weapon is thus automatically a weapon of radiological warfare, but its fallout decays much more rapidly than that of a cobalt bomb. A cobalt bomb's fallout on the other hand would render affected areas effectively stuck in this interim state for decades: habitable, but not safe for constant habitation.

Initially, gamma radiation from the fission products of an equivalent size fission-fusion-fission bomb are much more intense than Co-60: 15,000 times more intense at 1 hour; 35 times more intense at 1 week; 5 times more intense at 1 month; and about equal at 6 months. Thereafter fission product fallout radiation levels drop off rapidly, so that Co-60 fallout is 8 times more intense than fission at 1 year and 150 times more intense at 5 years. The very long-lived isotopes produced by fission would overtake the 60Co again after about 75 years.

Complete 100% conversion into Co-60 is unlikely; a 1957 British experiment at Maralinga showed that Co-59's neutron absorption ability was much lower than predicted, resulting in a very limited formation of Co-60 isotope in practice.

In addition, fallout is not deposited evenly throughout the path downwind from a detonation, so some areas would be relatively unaffected by fallout and the Earth would not be universally rendered lifeless by a cobalt bomb. The fallout and devastation following a nuclear detonation does not scale upwards linearly with the explosive yield (equivalent to tons of TNT). As a result, the concept of "overkill"—the idea that one can simply estimate the destruction and fallout created by a thermonuclear weapon of the size postulated by Leo Szilard's "cobalt bomb" thought experiment by extrapolating from the effects of thermonuclear weapons of smaller yields—is fallacious. However, nuclear devices exploded at high altitudes result in much more widespread but slower fallout, especially for dirty or cobalt-like weapons. The radioactive isotopes are caught in the natural global meteorological processes which, because of the extraordinary hardiness of the isotope, will cycle many times throughout the condensation and evaporation process, resulting in global spread and the effective destruction of usable water for plants, land animals, humans, and sea life.

Example of radiation levels vs. time

For the type of radiation given by a cobalt bomb, the dosage measured in sievert (Sv) and gray (Gy) can be treated as equivalent. This is because the relevant harmful radiation from cobalt-60 is gamma rays. When converting between sievert and gray for gamma rays, the radiation type weighting factor will be 1, and the radiation will be a highly penetrating radiation spread evenly over the body so the tissue type weighting factor will also be 1.

Assume a cobalt bomb deposits intense fallout causing a dose rate of 10 Sv per hour. At this dose rate, any unsheltered person exposed to the fallout would receive a lethal dose in about 30 minutes (assuming a median lethal dose of 5 Sv). People in well-built shelters would be safe due to radiation shielding.

  • After one half-life of 5.27 years, only half of the cobalt-60 will have decayed, and the dose rate in the affected area would be 5 Sv/hour. At this dose rate, a person exposed to the radiation would receive a lethal dose in 1 hour.
  • After 10 half-lives (about 53 years), the dose rate would have decayed to around 10 mSv/hour. At this point, a healthy person could spend up to 4 days exposed to the fallout with no immediate effects. Long-term effects from this exposure would be increased risk to develop cancer. At the 4th day, the accumulated dose will be about 1 Sv, at which point the first symptoms of acute radiation syndrome may appear.
  • After 20 half-lives (about 105 years), the dose rate would have decayed to around 10 μSv/hour. At this stage, humans could remain unsheltered full-time since their yearly radiation dose would be about 80 mSv. This yearly dose rate is about 30 times greater than the average natural background radiation rate of 2.4 mSv/year, but within its variability. At this dose rate, causal connection to cancer incidence would be difficult to establish.
  • After 25 half-lives (about 130 years), the dose rate from cobalt-60 would have decayed to less than 0.4 μSv/hour and could be considered negligible.

Decontamination

It may be possible to decontaminate relatively small areas contaminated by a cobalt bomb with equipment such as excavators and bulldozers covered with lead glass, similar to those employed in the Lake Chagan project. By skimming off the thin layer of fallout on the topsoil surface and burying it in the likes of a deep trench along with isolating it from ground water sources, the gamma air dose is cut by orders of magnitude. The decontamination after the Goiânia accident in Brazil in 1987 and the possibility of a "dirty bomb" with Co-60, which has similarities with the environment that one would be faced with after a nuclear yielding cobalt bomb's fallout had settled, has prompted the invention of "Sequestration Coatings" and cheap liquid phase sorbents for Co-60 that would further aid in decontamination, including that of water.

In popular culture

  • In Nevil Shute's novel On the Beach (1957), cobalt bombs are mentioned as the cause of the lethal radioactivity that is approaching Australia. The cobalt bomb was a symbol of man's hubris.
  • In City of Fear (1959), an escaped convict from San Quentin State Prison steals a canister of cobalt-60, thinking it contains drugs. He flees to Los Angeles to pawn it, not knowing it could kill him and possibly contaminate the city.
  • In the dark comedy Dr. Strangelove, or: How I Learned to Stop Worrying and Love the Bomb (1964), a type of cobalt-salted bomb is employed, specifically utilizing a composite called 'Cobalt-Thorium G' with a Dead Hand mechanism, by the Soviet Union as a 'doomsday device' nuclear deterrent: if the system detects any nuclear attack, the doomsday device will be automatically unleashed. With unfortunate timing, a deranged American general mutinies and orders an attack on the USSR before the Soviet secret device, already activated, could be unveiled to the world. One American bomber piloted by a hapless and unknowing crew gets through to their target; the Dead Hand mechanism works as designed and initiates a worldwide nuclear holocaust. In the film, the Soviet Ambassador says, "If you take, say, fifty H-bombs in the hundred megaton range and jacket them with Cobalt-Thorium G, when they are exploded they will produce a doomsday shroud. A lethal cloud of radioactivity which will encircle the earth for ninety-three years!"
  • In the James Bond film Goldfinger (1964), the title character informs Bond he intends to set off a "particularly dirty" atomic device using "cobalt and iodine" in the U.S. Bullion Repository at Fort Knox as part of Operation Grand Slam, a scheme intended to contaminate the gold at Fort Knox to increase value of the gold he has been stockpiling.
  • In Roger Zelazny's 1965 Hugo Award-winning novel This Immortal, Earth has suffered a nuclear war many decades ago and some areas still suffer high radiation levels from cobalt bombs, leading to drastic mutations and ecological changes.
  • In the fourth act of the classic Star Trek episode "Obsession" (1967), Ensign Garrovick states that 10,000 cobalt bombs would be less powerful than one ounce of antimatter.
  • In Beneath the Planet of the Apes (1970) the main character, upon seeing an underground mutant community worship a doomsday bomb, comments "They finally built one with a cobalt casing" in reference to a cobalt bomb that could wipe out the world. After astronauts Brent and Taylor are shot by an invading army of apes, Taylor's dying act is to detonate the doomsday bomb, obliterating all life on fortieth-century Earth.
  • In a two-part episode of the TV show The Bionic Woman, "Doomsday Is Tomorrow", a cobalt bomb, dubbed by its creator as "the most diabolical instrument of destruction ever conceived by man" is used as a trigger for a more powerful weapon that can render the world lifeless.
  • In Tom Clancy's novel The Sum of All Fears (1991) it is noted that Israeli Air Force tactical nuclear bombs can optionally be fitted with cobalt jackets "to poison a landscape to all kinds of life for years to come".
  • In the Doctor Who New Adventures novel Timewyrm: Genesys (1991), the planet Anu was destroyed by a cobalt bomb in the year 2,700 BC. The cyborg responsible escapes in a spacecraft, which crashes in ancient Mesopotamia. After adopting the guise of the goddess Ishtar, she builds another cobalt bomb in the city of Kish to threaten the Seventh Doctor, Gilgamesh, and the city's king with the destruction of the Earth if they should interfere with her plans for world domination. This second bomb is later used as a nuclear power source for a spacecraft, allowing the surviving refugees of Anu to travel to a new homeworld.
  • In the video game Detroit: Become Human (2018), the player has the option of detonating an improvised cobalt bomb during certain endings of the game. The detonation of the bomb results in humans evacuating the now-irradiated city of Detroit and the area 50 miles around, though promising to retake it from the androids in the future. Depending on the player's actions, the city is left empty or the androids claim it for their own.
  • In the video game Metro Exodus (2019), the player visits the Russian city of Novosibirsk which was hit with at least one cobalt warhead during a worldwide nuclear war in the year 2013, resulting in catastrophic levels of radiation, and easily the most irradiated area visited in the three Metro games. While the city is left largely standing even twenty years after the cobalt warhead's detonation, the radiation in the city is so lethal that even with lead-lined full enclosure suits, the player can only spend a few minutes on the surface before receiving lethal amounts of radiation poisoning. During their visit, the player discovers that the survivors of the attack survived underground for twenty-two years, but only due to constant injections of anti-radiation medicine.

Midnight sun

From Wikipedia, the free encyclopedia
Midnight sun at the North Cape on the island of Magerøya in Norway

Midnight sun is a natural phenomenon that occurs in the summer months in places north of the Arctic Circle or south of the Antarctic Circle, when the Sun remains visible at the local midnight. When midnight sun is seen in the Arctic, the Sun appears to move from left to right. In Antarctica, the equivalent apparent motion is from right to left. This occurs at latitudes from 65°44' to 90° north or south, and does not stop exactly at the Arctic Circle or the Antarctic Circle, due to refraction.

The opposite phenomenon, polar night, occurs in winter, when the Sun stays below the horizon throughout the day.

Details

Multiple exposure of midnight sun on Lake Ozhogino in Yakutia, Russia

Around the summer solstice (approximately 21 June in the Northern Hemisphere and 21 December in the Southern Hemisphere), in certain areas the Sun does not set below the horizon within a 24-hour period.

Geography

Because there are no permanent human settlements south of the Antarctic Circle, apart from research stations, the countries and territories whose populations experience midnight sun are limited to those crossed by the Arctic Circle: Canada (Yukon, Nunavut, and Northwest Territories), Finland, Greenland, Iceland, Norway, Russia, Sweden, and the United States (state of Alaska).

The largest city in the world north of the Arctic Circle, Murmansk, Russia, experiences midnight sun from 22 May to 22 July (62 days).

A quarter of Finland's territory lies north of the Arctic Circle, and at the country's northernmost point the Sun does not set at all for 72 days during summer.

In Svalbard, Norway, the northernmost inhabited region of Europe, there is no sunset from approximately 19 April to 23 August. The extreme sites are the poles, where the Sun can be continuously visible for half the year. The North Pole has midnight sun for 6 months, from late March to late September.

Polar circle proximity

Because of atmospheric refraction, and also because the Sun is a disc rather than a point in the sky, midnight sun may be experienced at latitudes slightly south of the Arctic Circle or north of the Antarctic Circle, though not exceeding one degree (depending on local conditions). For example, Iceland is known for its midnight sun, even though most of it (Grímsey is the exception) is slightly south of the Arctic Circle. For the same reasons, the period of sunlight at the poles is slightly longer than six months. Even the northern extremities of the United Kingdom (and places at similar latitudes, such as Saint Petersburg) experience twilight throughout the night in the northern sky at around the summer solstice.

Places sufficiently close to the poles, such as Alert, Nunavut, experience times where it does not get entirely dark at night yet the Sun does not rise either, combining effects of midnight sun and polar night, reaching civil twilight during the "day" and astronomical twilight at "night".

White nights

Locations where the Sun remains less than 6 (or 7) degrees below the horizon – between 60° 34’ (or 59° 34’) latitude and the polar circle – experience midnight twilight instead of midnight sun, so that daytime activities, such as reading, are still possible without artificial light on a clear night. This happens in both Northern Hemisphere summer solstice and Southern Hemisphere summer solstice. The lowest latitude to experience midnight sun without a golden hour is 72°33′43″ North or South.

Embankment of the Neva river in Saint Petersburg, 23:30 local time.
Month Lowest latitude to
experience white night
Lowest latitude to
experience midnight sun
Lowest latitude to
experience 100% darkness
January 59º 45' S 65º 55' S 48º 45' S
February 64º 45' S 70º 55' S 53º 45' S
March
(before equinox)
74º 45' S 80º 55' S 63º 45' S
March
(after equinox)
78º 00' N 84º 10' N 67º 00' N
April 68º 00' N 74º 10' N 57º 00' N
May 61º 00' N 67º 10' N 50º 00' N
June 59º 34' N 65º 44' N 48º 34' N
July 59º 45' N 65º 55' N 48º 45' N
August 64º 45' N 70º 55' N 53º 45' N
September
(before equinox)
74º 45' N 80º 55' N 63º 45' N
September
(after equinox)
78º 00' S 84º 10' S 67º 00' S
October 68º 00' S 74º 10' S 57º 00' S
November 61º 00' S 67º 10' S 50º 00' S
December 59º 34' S 65º 44' S 48º 34' S

White Nights have become a common symbol of Saint Petersburg, Russia, where they occur from about 11 June to 1 July,[2] and the last 10 days of June are celebrated with cultural events known as the White Nights Festival.

The northernmost tip of Antarctica also experiences white nights near the Southern Hemisphere summer solstice.

Explanation

Since the axial tilt of Earth is considerable (23 degrees, 26 minutes, 21.41196 seconds), at high latitudes the Sun does not set in summer; rather, it remains continuously visible for one day during the summer solstice at the polar circle, for several weeks only 100 km (62 mi) closer to the pole, and for six months at the pole. At extreme latitudes, midnight sun is usually referred to as polar day.

At the poles themselves, the Sun rises and sets only once each year on the equinox. During the six months that the Sun is above the horizon, it spends the days appearing to continuously move in circles around the observer, gradually spiralling higher and reaching its highest circuit of the sky at the summer solstice.

Time zones and daylight saving time

Summer night in the city of Pori on July 2, 2010

The term "midnight sun" refers to the consecutive 24-hour periods of sunlight experienced north of the Arctic Circle and south of the Antarctic Circle. Other phenomena are sometimes referred to as "midnight sun", but they are caused by time zones and the observance of daylight saving time. For instance, in Fairbanks, Alaska, which is south of the Arctic Circle, the Sun sets at 12:47 a.m. at the summer solstice. This is because Fairbanks is 51 minutes ahead of its idealized time zone (as most of the state is in one time zone) and Alaska observes daylight saving time. (Fairbanks is at about 147.72 degrees west, corresponding to UTC−9 hours 51 minutes, and is on UTC−9 in winter.) This means that solar culmination occurs at about 12:51 p.m. instead of at 12 noon.

If a precise moment for the genuine "midnight sun" is required, the observer's longitude, the local civil time, and the equation of time must be taken into account. The moment of the Sun's closest approach to the horizon coincides with its passing due north at the observer's position, which occurs only approximately at midnight in general. Each degree of longitude east of the Greenwich meridian makes the vital moment exactly 4 minutes earlier than midnight as shown on the clock, while each hour that the local civil time is ahead of coordinated universal time (UTC, also known as GMT) makes the moment an hour later. These two effects must be added. Furthermore, the equation of time (which depends on the date) must be added: a positive value on a given date means that the Sun is running slightly ahead of its average position, so the value must be subtracted.

As an example, at the North Cape of Norway at midnight on June 21/22, the longitude of 25.9 degrees east makes the moment 103.2 minutes earlier by clock time; but the local time, 2 hours ahead of GMT in the summer, makes it 120 minutes later by clock time. The equation of time at that date is -2.0 minutes. Therefore, the Sun's lowest elevation occurs 120 - 103.2 + 2.0 minutes after midnight: at 00.19 Central European Summer time. On other nearby dates the only thing different is the equation of time, so this remains a reasonable estimate for a considerable period. The Sun's altitude remains within half a degree of the minimum of about 5 degrees for about 45 minutes either side of this time.

When it rotates on its own axis, it sometimes moves closer to the Sun. During this period of Earth's rotation from May to July, Earth tilts at an angle of 23.5 degrees above its own axis in its orbit. This causes the part of Norway located in the Arctic region at the North Pole of Earth to move very close to the Sun and during this time the length of the day increases. It can be said that it almost never subsides. Night falls in Norway's Hammerfest at this particular time of year.

Map showing the dates of midnight sun at various latitudes (left) and the total number of nights

Duration

The number of days per year with potential midnight sun increases the closer one goes toward either pole. Although approximately defined by the polar circles, in practice, midnight sun can be seen as much as 90 km (56 mi) outside the polar circle, as described below, and the exact latitudes of the farthest reaches of midnight sun depend on topography and vary slightly from year to year.

Even though at the Arctic Circle the center of the Sun is, per definition and without refraction by the atmosphere, only visible during one summer night, some part of midnight sun is visible at the Arctic Circle from approximately 12 June until 1 July. This period extends as one travels north: At Cape Nordkinn, Norway, the northernmost point of Continental Europe, midnight sun lasts approximately from 14 May to 29 July. On the Svalbard archipelago farther north, it lasts from 20 April to 22 August.

Southern and Northern poles

Also, the periods of polar day and polar night are unequal in both polar regions because the Earth is at perihelion in early January and at aphelion in early July. As a result, the polar day is longer than the polar night in the Northern Hemisphere (at Utqiagvik, Alaska, for example, polar day lasts 84 days, while polar night lasts only 68 days), while in the Southern Hemisphere, the situation is the reverse—the polar night is longer than the polar day.

Observers at heights appreciably above sea level can experience extended periods of midnight sun as a result of the "dip" of the horizon viewed from altitude.

Bubonic plague

From Wikipedia, the free encyclopedia https://en.wikipedia.org/wiki/Bubonic_plague   Bubonic pla...