Search This Blog

Monday, November 29, 2021

Epigenetic clock

From Wikipedia, the free encyclopedia
Jump to navigation Jump to search

An epigenetic clock is a biochemical test that can be used to measure age. The test is based on DNA methylation levels, measuring the accumulation of methyl groups to one's DNA molecules.

History

The strong effects of age on DNA methylation levels have been known since the late 1960s. A vast literature describes sets of CpGs whose DNA methylation levels correlate with age, e.g. The first robust demonstration that DNA methylation levels in saliva could generate age predictors with an average accuracy of 5.2 years was published by a UCLA team including Sven Bocklandt, Steve Horvath, and Eric Vilain in 2011 (Bocklandt et al. 2011). The labs of Trey Ideker and Kang Zhang at the University of California, San Diego published the Hannum epigenetic clock (Hannum 2013), which consisted of 71 markers that accurately estimate age based on blood methylation levels. The first multi-tissue epigenetic clock, Horvath's epigenetic clock, was developed by Steve Horvath, a professor of human genetics and of biostatistics at UCLA (Horvath 2013). Horvath spent over 4 years collecting publicly available Illumina DNA methylation data and identifying suitable statistical methods.

The personal story behind the discovery was featured in Nature. The age estimator was developed using 8,000 samples from 82 Illumina DNA methylation array datasets, encompassing 51 healthy tissues and cell types. The major innovation of Horvath's epigenetic clock lies in its wide applicability: the same set of 353 CpGs and the same prediction algorithm is used irrespective of the DNA source within the organism, i.e. it does not require any adjustments or offsets. This property allows one to compare the ages of different areas of the human body using the same aging clock.

Relationship to a cause of biological aging

It is not yet known what exactly is measured by DNA methylation age. Horvath hypothesized that DNA methylation age measures the cumulative effect of an epigenetic maintenance system but details are unknown. The fact that DNA methylation age of blood predicts all-cause mortality in later life has been used to argue that it relates to a process that causes aging. However, if a particular CpG played a direct causal role in the aging process, the mortality it created would make it less likely to be observed in older individuals, making the site less likely to have been chosen as a predictor; the 353 clock CpGs therefore likely have no causal effect whatsoever. Rather, the epigenetic clock captures an emergent property of the epigenome.

Epigenetic clock theory of aging

In 2010, a new unifying model of aging and the development of complex diseases was proposed, incorporating classical aging theories and epigenetics. Horvath and Raj extended this theory, proposing an epigenetic clock theory of aging with the following tenets:

  • Biological aging results as an unintended consequence of both developmental programs and maintenance program, the molecular footprints of which give rise to DNA methylation age estimators.
  • The precise mechanisms linking the innate molecular processes (underlying DNAm age) to the decline in tissue function probably relate to both intracellular changes (leading to a loss of cellular identity) and subtle changes in cell composition, for example, fully functioning somatic stem cells.
  • At the molecular level, DNAm age is a proximal readout of a collection of innate aging processes that conspire with other, independent root causes of ageing to the detriment of tissue function.

Motivation for biological clocks

In general, biological aging clocks and biomarkers of aging are expected to find many uses in biological research since age is a fundamental characteristic of most organisms. Accurate measures of biological age (biological aging clocks) could be useful for

Overall, biological clocks are expected to be useful for studying what causes aging and what can be done against it. However, they can only capture the effects of interventions that affect the rate of future aging, i.e. the slope of the Gompertz curve by which mortality increases with age, and not that of interventions that act at one moment in time, e.g. to lower mortality across all ages, i.e. the intercept of the Gompertz curve.

Properties of Horvath's clock

The clock is defined as an age estimation method based on 353 epigenetic markers on the DNA. The 353 markers measure DNA methylation of CpG dinucleotides. Estimated age ("predicted age" in mathematical usage), also referred to as DNA methylation age, has the following properties: first, it is close to zero for embryonic and induced pluripotent stem cells; second, it correlates with cell passage number; third, it gives rise to a highly heritable measure of age acceleration; and, fourth, it is applicable to chimpanzee tissues (which are used as human analogs for biological testing purposes). Organismal growth (and concomitant cell division) leads to a high ticking rate of the epigenetic clock that slows down to a constant ticking rate (linear dependence) after adulthood (age 20). The fact that DNA methylation age of blood predicts all-cause mortality in later life even after adjusting for known risk factors is compatible with a variety of causal relationships, e.g. a common cause for both. Similarly, markers of physical and mental fitness are associated with the epigenetic clock (lower abilities associated with age acceleration). It systematically underestimates age from older individuals.

Salient features of Horvath's epigenetic clock include its applicability to a broad spectrum of tissues and cell types. Since it allows one to contrast the ages of different tissues from the same subject, it can be used to identify tissues that show evidence of accelerated age due to disease.

Statistical approach

The basic approach is to form a weighted average of the 353 clock CpGs, which is then transformed to DNAm age using a calibration function. The calibration function reveals that the epigenetic clock has a high ticking rate until adulthood, after which it slows to a constant ticking rate. Using the training data sets, Horvath used a penalized regression model (Elastic net regularization) to regress a calibrated version of chronological age on 21,369 CpG probes that were present both on the Illumina 450K and 27K platform and had fewer than 10 missing values. DNAm age is defined as estimated ("predicted") age. The elastic net predictor automatically selected 353 CpGs. 193 of the 353 CpGs correlate positively with age while the remaining 160 CpGs correlate negatively with age. R software and a freely available web-based tool can be found at the following webpage.

Accuracy

The median error of estimated age is 3.6 years across a wide spectrum of tissues and cell types, although this increases for older individuals. The epigenetic clock performs well in heterogeneous tissues (for example, whole blood, peripheral blood mononuclear cells, cerebellar samples, occipital cortex, buccal epithelium, colon, adipose, kidney, liver, lung, saliva, uterine cervix, epidermis, muscle) as well as in individual cell types such as CD4 T cells, CD14 monocytes, glial cells, neurons, immortalized B cells, mesenchymal stromal cells. However, accuracy depends to some extent on the source of the DNA.

Comparison with other biological clocks

The epigenetic clock leads to a chronological age prediction that has a Pearson correlation coefficient of r = 0.96 with chronological age (Figure 2 in). Thus the age correlation is close to its maximum possible correlation value of 1. Other biological clocks are based on a) telomere length, b) p16INK4a expression levels (also known as INK4a/ARF locus), and c) microsatellite mutations. The correlation between chronological age and telomere length is r = −0.51 in women and r = −0.55 in men. The correlation between chronological age and expression levels of p16INK4a in T cells is r = 0.56.

Applications of Horvath's clock

By contrasting DNA methylation age (estimated age) with chronological age, one can define measures of age acceleration. Age acceleration can be defined as the difference between DNA methylation age and chronological age. Alternatively, it can be defined as the residual that results from regressing DNAm age on chronological age. The latter measure is attractive because it does not correlate with chronological age. A positive/negative value of epigenetic age acceleration suggests that the underlying tissue ages faster/slower than expected.

Genetic studies of epigenetic age acceleration

The broad sense heritability (defined via Falconer's formula) of age acceleration of blood from older subjects is around 40% but it appears to be much higher in newborns. Similarly, the age acceleration of brain tissue (prefrontal cortex) was found to be 41% in older subjects. Genome-wide association studies (GWAS) of epigenetic age acceleration in postmortem brain samples have identified several SNPs at a genomewide significance level. GWAS of age acceleration in blood have identified several genome-wide significant genetic loci including the telomerase reverse transcriptase gene (TERT) locus. Genetic variants associated with longer leukocyte telomere length in TERT gene paradoxically confer higher epigenetic age acceleration in blood.

Lifestyle factors

In general, lifestyle factors have only weak associations with epigenetic age acceleration in blood. Cross sectional studies of extrinsic epigenetic aging rates in blood show reduced epigenetic aging correlates with higher education, eating a high plant diet with lean meats, moderate alcohol consumption, and physical activity and the risks associated with metabolic syndrome. However, studies suggest that high levels of alcohol consumption are associated with accelerated aging of certain epigenetic clocks.

Obesity and metabolic syndrome

The epigenetic clock was used to study the relationship between high body mass index (BMI) and the DNA methylation ages of human blood, liver, muscle and adipose tissue. A significant correlation (r = 0.42) between BMI and epigenetic age acceleration could be observed for the liver. A much larger sample size (n = 4200 blood samples) revealed a weak but statistically significant correlation (r = 0.09) between BMI and intrinsic age acceleration of blood. The same large study found that various biomarkers of metabolic syndrome (glucose-, insulin-, triglyceride levels, C-reactive protein, waist-to-hip ratio) were associated with epigenetic age acceleration in blood. Conversely, high levels of the good cholesterol HDL were associated with a lower epigenetic aging rate of blood. Other research suggests very strong associations between higher body mass index, waist-to-hip ratio, and waist circumference and accelerated epigenetic clocks, with evidence that physical activity may lessen these effects. 

Female breast tissue is older than expected

DNAm age is higher than chronological age in female breast tissue that is adjacent to breast cancer tissue. Since normal tissue which is adjacent to other cancer types does not exhibit a similar age acceleration effect, this finding suggests that normal female breast tissue ages faster than other parts of the body. Similarly, normal breast tissue samples from women without cancer have been found to be substantially older than blood samples collected from the same women at the same time.

Female breast cancer

In a study of three epigenetic clocks and breast cancer risk, DNAm age was found to be accelerated in blood samples of cancer-free women, years before diagnosis.

Cancer tissue

Cancer tissues show both positive and negative age acceleration effects. For most tumor types, no significant relationship can be observed between age acceleration and tumor morphology (grade/stage). On average, cancer tissues with mutated TP53 have a lower age acceleration than those without it. Further, cancer tissues with high age acceleration tend to have fewer somatic mutations than those with low age acceleration. Age acceleration is highly related to various genomic aberrations in cancer tissues. Somatic mutations in estrogen receptors or progesterone receptors are associated with accelerated DNAm age in breast cancer. Colorectal cancer samples with a BRAF (V600E) mutation or promoter hypermethylation of the mismatch repair gene MLH1 are associated with an increased age acceleration. Age acceleration in glioblastoma multiforme samples is highly significantly associated with certain mutations in H3F3A. One study suggests that the epigenetic age of blood tissue may be prognostic of lung cancer incidence.

Trisomy 21 (Down syndrome)

Down syndrome entails an increased risk of many chronic diseases that are typically associated with older age. The clinical manifestations of accelerated aging suggest that trisomy 21 increases the biological age of tissues, but molecular evidence for this hypothesis has been sparse. According to the epigenetic clock, trisomy 21 significantly increases the age of blood and brain tissue (on average by 6.6 years).

Alzheimer's disease related neuropathology

Epigenetic age acceleration of the human prefrontal cortex was found to be correlated with several neuropathological measurements that play a role in Alzheimer's disease Further, it was found to be associated with a decline in global cognitive functioning, and memory functioning among individuals with Alzheimer's disease. The epigenetic age of blood relates to cognitive functioning in the elderly. Overall, these results strongly suggest that the epigenetic clock lends itself for measuring the biological age of the brain.

Cerebellum ages slowly

It has been difficult to identify tissues that seem to evade aging due to the lack of biomarkers of tissue age that allow one to contrast compare the ages of different tissues. An application of epigenetic clock to 30 anatomic sites from six centenarians and younger subjects revealed that the cerebellum ages slowly: it is about 15 years younger than expected in a centenarian. This finding might explain why the cerebellum exhibits fewer neuropathological hallmarks of age related dementias compared to other brain regions. In younger subjects (e.g. younger than 70), brain regions and brain cells appear to have roughly the same age. Several SNPs and genes have been identified that relate to the epigenetic age of the cerebellum.

Huntington's disease

Huntington's disease has been found to increase the epigenetic aging rates of several human brain regions.

Centenarians age slowly

The offspring of semi-supercentenarians (subjects who reached an age of 105–109 years) have a lower epigenetic age than age-matched controls (age difference = 5.1 years in blood) and centenarians are younger (8.6 years) than expected based on their chronological age.

HIV infection

Infection with the Human Immunodeficiency Virus-1 (HIV) is associated with clinical symptoms of accelerated aging, as evidenced by increased incidence and diversity of age-related illnesses at relatively young ages. But it has been difficult to detect an accelerated aging effect on a molecular level. An epigenetic clock analysis of human DNA from HIV+ subjects and controls detected a significant age acceleration effect in brain (7.4 years) and blood (5.2 years) tissue due to HIV-1 infection. These results are consistent with an independent study that also found an age advancement of 5 years in blood of HIV patients and a strong effect of the HLA locus.

Parkinson's disease

A large-scale study suggests that the blood of Parkinson's disease subjects exhibits (relatively weak) accelerated aging effects.

Developmental disorder: syndrome X

Children with a very rare disorder known as syndrome X maintain the façade of persistent toddler-like features while aging from birth to adulthood. Since the physical development of these children is dramatically delayed, these children appear to be a toddler or at best a preschooler. According to an epigenetic clock analysis, blood tissue from syndrome X cases is not younger than expected.

Menopause accelerates epigenetic aging

The following results strongly suggest that the loss of female hormones resulting from menopause accelerates the epigenetic aging rate of blood and possibly that of other tissues. First, early menopause has been found to be associated with an increased epigenetic age acceleration of blood. Second, surgical menopause (due to bilateral oophorectomy) is associated with epigenetic age acceleration in blood and saliva. Third, menopausal hormone therapy, which mitigates hormonal loss, is associated with a negative age acceleration of buccal cells (but not of blood cells). Fourth, genetic markers that are associated with early menopause are also associated with increased epigenetic age acceleration in blood.

Cellular senescence versus epigenetic aging

A confounding aspect of biological aging is the nature and role of senescent cells. It is unclear whether the three major types of cellular senescence, namely replicative senescence, oncogene-induced senescence and DNA damage-induced senescence are descriptions of the same phenomenon instigated by different sources, or if each of these is distinct, and how they are associated with epigenetic aging. Induction of replicative senescence (RS) and oncogene-induced senescence (OIS) were found to be accompanied by epigenetic aging of primary cells but senescence induced by DNA damage was not, even though RS and OIS activate the cellular DNA damage response pathway. These results highlight the independence of cellular senescence from epigenetic aging. Consistent with this, telomerase-immortalised cells continued to age (according to the epigenetic clock) without having been treated with any senescence inducers or DNA-damaging agents, re-affirming the independence of the process of epigenetic ageing from telomeres, cellular senescence, and the DNA damage response pathway. Although the uncoupling of senescence from cellular aging appears at first sight to be inconsistent with the fact that senescent cells contribute to the physical manifestation of organism ageing, as demonstrated by Baker et al., where removal of senescent cells slowed down aging.

The epigenetic clock analysis of senescence, however, suggests that cellular senescence is a state that cells are forced into as a result of external pressures such as DNA damage, ectopic oncogene expression and exhaustive proliferation of cells to replenish those eliminated by external/environmental factors. These senescent cells, in sufficient numbers, will probably cause the deterioration of tissues, which is interpreted as organism ageing. However, at the cellular level, aging, as measured by the epigenetic clock, is distinct from senescence. It is an intrinsic mechanism that exists from the birth of the cell and continues. This implies that if cells are not shunted into senescence by the external pressures described above, they would still continue to age. This is consistent with the fact that mice with naturally long telomeres still age and eventually die even though their telomere lengths are far longer than the critical limit, and they age prematurely when their telomeres are forcibly shortened, due to replicative senescence. Therefore, cellular senescence is a route by which cells exit prematurely from the natural course of cellular aging.

Effect of sex and race/ethnicity

Men age faster than women according to epigenetic age acceleration in blood, brain, saliva, but it depends on the structure being researched and the lifestyle. The epigenetic clock method applies to all examined racial/ethnic groups in the sense that DNAm age is highly correlated with chronological age. But ethnicity can be associated with epigenetic age acceleration. For example, the blood of Hispanics and the Tsimané ages more slowly than that of other populations which might explain the Hispanic mortality paradox.

Rejuvenation effect due to stem cell transplantation in blood

Hematopoietic stem cell transplantation, which transplants these cells from a young donor to an older recipient, rejuvenates the epigenetic age of blood to that of the donor. However, graft-versus-host disease is associated with increased DNA methylation age.

Progeria

Adult progeria also known as Werner syndrome is associated with epigenetic age acceleration in blood. Fibroblast samples from children with Hutchinson-Gilford Progeria exhibit accelerated epigenetic aging effects according to the "skin & blood" epigenetic clock but not according to the original pan tissue clock from Horvath.

Biological mechanism behind the epigenetic clock

Despite the fact that biomarkers of ageing based on DNA methylation data have enabled accurate age estimates for any tissue across the entire life course, the precise biological mechanism behind the epigenetic clock is currently unknown. However, epigenetic biomarkers may help to address long-standing questions in many fields, including the central question: why do we age? To understand the essence of mechanisms behind the epigenetic clock, it would be advisable to make a comparison and find the relationship between the readings of the epigenetic clock and the transcriptome aging clock The following explanations have been proposed for now in the literature.

Possible explanation 1: Epigenomic maintenance system

Horvath hypothesized that his clock arises from a methylation footprint left by an epigenomic maintenance system.

Possible explanation 2: Unrepaired DNA damages

Endogenous DNA damages occur frequently including about 50 double-strand DNA breaks per cell cycle and about 10,000 oxidative damages per day (see DNA damage (naturally occurring)). During repair of double-strand breaks many epigenetic alterations are introduced, and in a percentage of cases epigenetic alterations remain after repair is completed, including increased methylation of CpG island promoters. Similar, but usually transient epigenetic alterations were recently found during repair of oxidative damages caused by H2O2, and it was suggested that occasionally these epigenetic alterations may also remain after repair. These accumulated epigenetic alterations may contribute to the epigenetic clock. Accumulation of epigenetic alterations may parallel the accumulation of un-repaired DNA damages that are proposed to cause aging.

Other age estimators based on DNA methylation levels

Several other age estimators have been described in the literature.

1) Weidner et al. (2014) describe an age estimator for DNA from blood that uses only three CpG sites of genes hardly affected by aging (cg25809905 in integrin, alpha 2b (ITGA2B); cg02228185 in aspartoacylase (ASPA) and cg17861230 in phosphodiesterase 4C, cAMP specific (PDE4C)). The age estimator by Weidener et al. (2014) applies only to blood. Even in blood this sparse estimator is far less accurate than Horvath's epigenetic clock (Horvath 2014) when applied to data generated by the Illumina 27K or 450K platforms. But the sparse estimator was developed for pyrosequencing data and is highly cost effective.

2) Hannum et al. (2013) report several age estimators: one for each tissue type. Each of these estimators requires covariate information (e.g. gender, body mass index, batch). The authors mention that each tissue led to a clear linear offset (intercept and slope). Therefore, the authors had to adjust the blood-based age estimator for each tissue type using a linear model. When the Hannum estimator is applied to other tissues, it leads to a high error (due to poor calibration) as can be seen from Figure 4A in Hannum et al. (2013). Hannum et al. adjusted their blood-based age estimator (by adjusting the slope and the intercept term) in order to apply it to other tissue types. Since this adjustment step removes differences between tissue, the blood-based estimator from Hannum et al. cannot be used to compare the ages of different tissues/organs. In contrast, a salient characteristic of the epigenetic clock is that one does not have to carry out such a calibration step: it always uses the same CpGs and the same coefficient values. Therefore, Horvath's epigenetic clock can be used to compare the ages of different tissues/cells/organs from the same individual. While the age estimators from Hannum et al. cannot be used to compare the ages of different normal tissues, they can be used to compare the age of a cancerous tissue with that of a corresponding normal (non-cancerous) tissue. Hannum et al. reported pronounced age acceleration effects in all cancers. In contrast, Horvath's epigenetic clock reveals that some cancer types (e.g. triple negative breast cancers or uterine corpus endometrial carcinoma) exhibit negative age acceleration, i.e. cancer tissue can be much younger than expected. An important difference relates to additional covariates. Hannum's age estimators make use of covariates such as gender, body mass index, diabetes status, ethnicity, and batch. Since new data involve different batches, one cannot apply it directly to new data. However, the authors present coefficient values for their CpGs in Supplementary Tables which can be used to define an aggregate measure that tends to be strongly correlated with chronological age but may be poorly calibrated (i.e. lead to high errors).

Comparison of the 3 age predictors described in A) Horvath (2013),[10] B) Hannum (2013),[9] and C) Weidener (2014),[61] respectively. The x-axis depicts the chronological age in years whereas the y-axis shows the predicted age. The solid black line corresponds to y=x. These results were generated in an independent blood methylation data set that was not used in the construction of these predictors (data generated in Nov 2014).

3) Giuliani et al. identify genomic regions whose DNA methylation level correlates with age in human teeth. They propose the evaluation of DNA methylation at ELOVL2, FHL2, and PENK genes in DNA recovered from both cementum and pulp of the same modern teeth. They wish to apply this method also to historical and relatively ancient human teeth.

4) Galkin et al. used deep neural networks to train an epigenetic aging clock of unprecedented accuracy using >6,000 blood samples. The clock uses information from 1000 CpG sites and predicts people with certain conditions older than healthy controls: IBD, frontotemporal dementia, ovarian cancer, obesity. The aging clock is planned to be released for public use in 2021 by an Insilico Medicine spinoff company Deep Longevity.

In a multicenter benchmarking study 18 research groups from three continents compared all promising methods for analyzing DNA methylation in the clinic and identified the most accurate methods, having concluded that epigenetic tests based on DNA methylation are a mature technology ready for broad clinical use.

Other species

Wang et al., (in mice livers) and Petkovich et al. (based on mice blood DNA methylation profiles) examined whether mice and humans experience similar patterns of change in the methylome with age. They found that mice treated with lifespan-extending interventions (such as calorie restriction or dietary rapamycin) were significantly younger in epigenetic age than their untreated, wild-type age-matched controls. Mice age predictors also detects the longevity effects of gene knockouts, and rejuvenation of fibroblast-derived.

Mice multi-tissue age predictor based on DNA methylation at 329 unique CpG sites reached a median absolute error of less than four weeks (~5 percent of lifespan). An attempt to use the human clock sites in mice for age predictions showed that the human clock is not fully conserved in mice. Differences between human and mouse clocks suggests that epigenetic clocks need to be trained specifically for different species.

A novel method of ageing lobsters was published in 2021 that used a ribosomal DNA methylation-based clock which may allow non-invasive sampling and ageing of wild European lobster populations (Homarus gammarus) 

Changes to DNA methylation patterns have great potential for age estimation and biomarker search in domestic and wild animals.

Sunday, November 28, 2021

Telomere

From Wikipedia, the free encyclopedia

Human chromosomes (grey) capped by telomeres (white)

A telomere (/ˈtɛləmɪər/ or /ˈtləmɪər/, from Ancient Greek: τέλος, romanizedtélos, lit.'end' and Ancient Greek: μέρος, romanizedméros, lit.'part') is a region of repetitive nucleotide sequences associated with specialized proteins at the ends of linear chromosomes. Although there are different architectures, telomeres, in a broad sense, are a widespread genetic feature most commonly found in eukaryotes. In most, if not all species possessing them, they protect the terminal regions of chromosomal DNA from progressive degradation and ensure the integrity of linear chromosomes by preventing DNA repair systems from mistaking the very ends of the DNA strand for a double strand break.

Discovery

In the early 1970s, Soviet theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends; this is called the "end replication problem". Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends.

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph G. Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.

In 1983, Barbara McClintock, an American cytogeneticist and the first woman to receive an unshared Nobel Prize in Physiology or Medicine, received the Nobel Prize for observing that the chromosomes lacking end parts became "sticky" and hypothesized the existence of a special structure at the chromosome tip that would maintain chromosome stability.

Structure and function

End replication problem

Lagging strand during DNA replication.

During DNA-replication, DNA polymerase cannot replicate the sequences present at the 3'-ends. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a primer to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of RNA) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see lagging strand replication). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes) would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated. It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70-100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50-100 base pairs per cell division.

If coding sequences are degraded in this process, potentially vital genetic code would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively degraded in the process of DNA replication.

The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most prokaryotes, relying on circular chromosomes, accordingly do not possess telomeres. A small fraction of bacterial chromosomes (such as those in Streptomyces, Agrobacterium, and Borrelia), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.

Telomere ends and shelterin

Shelterin co-ordinates the T-loop formation of telomeres.

At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1. In many species, the sequence repeats are enriched in guanine, e.g. TTAGGG in vertebrates, which allows the formation of G-quadruplexes, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in ciliates (that possess telomere repeats similar to those found in vertebrates) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes like DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription.

Telomerase

Synthesis of chromosome ends by telomerase

Many organisms have an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap." In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be reactivated and telomeres reset back to an embryonic state by somatic cell nuclear transfer. The steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Length

Telomere length varies greatly between species, from approximately 300 base pairs in yeast to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.

Role in the cell cycle

Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility. If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence), or begin programmed cell self-destruction (apoptosis) depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

Shortening

Oxidative damage

Apart from the end replication problem, in vitro studies have shown that telomeres accumulate damage due to oxidative stress and that oxidative stress-mediated DNA damage has a major influence on telomere shortening in vivo. There is a multitude of ways in which oxidative stress, mediated by reactive oxygen species (ROS), can lead to DNA damage; however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions. Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out; for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for. Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. These results  suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

Association with aging

Telomere shortening is associated with aging, mortality and aging-related diseases. Normal aging is associated with telomere shortening in both humans and mice, and studies on genetically modified animal models suggest causal links between telomere erosion and aging. However, it is not known whether short telomeres are just a symptom of senescence or if they themselves contribute to the progression of the aging process.

The age of a father plays a role in the length of a child’s telomeres, which has evolutionary implications. Although leukocyte telomeres shorten with age, sperm telomeres lengthen with age. Shorter telomeres are theorized to impose lower energy costs (due to less replication) but also have immune system-related and other aging- and disease-related costs, so the effect of paternal age on telomere length might be an adaptation to increase the chances that the child will be fit for the environment they’re born into.

Potential effect of psychological stress

Meta-analyses found that increased perceived psychological stress was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for publication bias. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life.

Lengthening

The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The Hayflick limit is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.

It is becoming apparent that reversing shortening of telomeres through temporary activation of telomerase may be a potent means to slow aging. The reason that this would extend human life is because it would extend the Hayflick limit. Three routes have been proposed to reverse telomere shortening: drugs, gene therapy, or metabolic suppression, so-called torpor/hibernation. So far these ideas have not been proven in humans, but it has been demonstrated that telomere shortening is reversed in hibernation and aging is slowed (Turbill, et al. 2012 & 2013) and that hibernation prolongs life-span (Lyman et al. 1981). It has also been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice and the nematode worm species Caenorhabditis elegans. It has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer (e.g. Weinstein and Ciszek, 2002). However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption.

Elizabeth Blackburn points to studies showing exercise, adequate sleep, and healthy diet correlate with telomere length maintenance in humans, as measured in white blood cells. Genetic predisposition for high telomere maintenance correlates with higher risk for certain types of aggressive cancer (melanoma, glioblastoma, chronic lymphocytic leukemia), pointing to a potential hazard for telomerase-enhancing drugs.

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another unrelated, long-lived seabird species, the great frigatebird (Fregata minor), telomere length did decrease until at least c. 40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

Furthermore, Gomes et al. found, in a study of the comparative biology of mammalian telomeres, that telomere length of different mammalian species correlates inversely, rather than directly, with lifespan, and they concluded that the contribution of telomere length to lifespan remains controversial. Harris et al. found little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities. Gilley and Blackburn tested whether cellular senescence in paramecium is caused by telomere shortening, and found that telomeres were not shortened during senescence.

Sequences

Known, up-to-date telomere nucleotide sequences are listed in Telomerase Database website.

Some known telomere nucleotide sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG
Allium CTCGGTTATGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Research on disease risk

Telomeres are critical for maintaining genomic integrity and may be factors for age-related diseases. Research has found a strong link between shorter length of telomeres and increased risk for some chronic diseases such as type 2 diabetes, cancer, cardiovascular and Alzheimer's disease. During aging process, as the length of telomeres shortens, its function of providing protection to the DNA within our chromosomes depletes which leads to cell aging. Laboratory studies show that telomere dysfunction or shortening is commonly acquired due process of cellular aging and tumor development. Short telomeres can lead to genomic instability, chromosome loss and the formation of non-reciprocal translocations; and telomeres in tumor cells and their precursor lesions are significantly shorter than surrounding normal tissue.

Observational studies have found shortened telomeres in many types of experimental cancers. In addition, people with cancer have been found to possess shorter leukocyte telomeres than healthy controls. Recent meta-analyses suggest 1.4 to 3.0 fold increased risk of cancer for those with the shortest vs. longest telomeres. However, the increase in risk varies by age, sex, tumor type, and differences in lifestyle factors.

Measurement

Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot. A Real-Time PCR assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.

Tools have also been developed to estimate the length of telomere from whole genome sequencing (WGS) experiments. Amongst these are TelSeq, Telomerecat and telomereHunter. Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. Flow-FISH is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006.

While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company, promoted the clinical utility of telomere length measures.

In wildlife

During the last two decades, eco-evolutionary studies have investigated the relevance of life-history traits and environmental conditions on wildlife telomeres. Most of these studies have been conducted in endotherms, i.e. birds and mammals. They have provided evidence for the inheritance of telomere length, however, heritability estimates vary greatly within and among species. Age and telomere length often negatively correlate in vertebrates, but this decline is variable among taxa and linked to the method used for estimating telomere length. In contrast, the available information shows no sex differences in telomere length across vertebrates. Phylogeny and life history traits such as body size or the pace of life can also affect wildlife telomeres, as for example it has been described across bird species. A recent meta-analysis confirms that the exposure to stressors (e.g. pathogen infection, competition, reproductive effort and high activity level) is associated with shorter telomeres across different animal taxa. Telomeres are also a candidate health biomarker for ecotoxicology studies, however, their use still needs further validation as the current literature is taxonomically biased and limited by a reduced number of experimental and longitudinal approaches.

Although ca. 80% of living animals are ectotherms, the knowledge about telomere dynamics in these species is still limited to a few studies in reptiles, fish, and amphibians, whereas invertebrates telomeres have been virtually not explored. Ectotherms are significantly more likely than endotherms to have variation in somatic telomerase expression. For instance, in many fish, telomerase occurs throughout the body (and associated with this, telomere length is roughly the same across all its tissue). Studies on ectotherms, and other non-mammalian organisms, show that there is no single universal model of telomere erosion; rather, there is wide variation in relevant dynamics across Metazoa, and even within smaller taxonomic groups these patterns appear diverse. Due to the different reproductive timelines of some ectotherms, selection on disease is relevant for a much larger fraction of these creatures’ lives than it is for mammals, so early- and late-life telomere length, and their possible links to cancer, seem especially important in these species from a life history theory point of view. Indeed, ectotherms are more sensitive to environmental variation than endotherms and factors like temperature are known to their growth and maturation rates, thus, ectothermic telomeres are predicted to be greatly affected by climate change.

Nanomedicine

From Wikipedia, the free encyclopedia
https://en.wikipedia.org/wiki/Nanomedicine

Nanomedicine is the medical application of nanotechnology. Nanomedicine ranges from the medical applications of nanomaterials and biological devices, to nanoelectronic biosensors, and even possible future applications of molecular nanotechnology such as biological machines. Current problems for nanomedicine involve understanding the issues related to toxicity and environmental impact of nanoscale materials (materials whose structure is on the scale of nanometers, i.e. billionths of a meter).

Functionalities can be added to nanomaterials by interfacing them with biological molecules or structures. The size of nanomaterials is similar to that of most biological molecules and structures; therefore, nanomaterials can be useful for both in vivo and in vitro biomedical research and applications. Thus far, the integration of nanomaterials with biology has led to the development of diagnostic devices, contrast agents, analytical tools, physical therapy applications, and drug delivery vehicles.

Nanomedicine seeks to deliver a valuable set of research tools and clinically useful devices in the near future. The National Nanotechnology Initiative expects new commercial applications in the pharmaceutical industry that may include advanced drug delivery systems, new therapies, and in vivo imaging. Nanomedicine research is receiving funding from the US National Institutes of Health Common Fund program, supporting four nanomedicine development centers.

Nanomedicine sales reached $16 billion in 2015, with a minimum of $3.8 billion in nanotechnology R&D being invested every year. Global funding for emerging nanotechnology increased by 45% per year in recent years, with product sales exceeding $1 trillion in 2013. As the nanomedicine industry continues to grow, it is expected to have a significant impact on the economy.

Drug delivery

Nanoparticles (top), liposomes (middle), and dendrimers (bottom) are some nanomaterials being investigated for use in nanomedicine.

Nanotechnology has provided the possibility of delivering drugs to specific cells using nanoparticles. The overall drug consumption and side-effects may be lowered significantly by depositing the active agent in the morbid region only and in no higher dose than needed. Targeted drug delivery is intended to reduce the side effects of drugs with concomitant decreases in consumption and treatment expenses. Drug delivery focuses on maximizing bioavailability both at specific places in the body and over a period of time. This can potentially be achieved by molecular targeting by nanoengineered devices. A benefit of using nanoscale for medical technologies is that smaller devices are less invasive and can possibly be implanted inside the body, plus biochemical reaction times are much shorter. These devices are faster and more sensitive than typical drug delivery. The efficacy of drug delivery through nanomedicine is largely based upon: a) efficient encapsulation of the drugs, b) successful delivery of drug to the targeted region of the body, and c) successful release of the drug. Several nano-delivery drugs were on the market by 2019.

Drug delivery systems, lipid- or polymer-based nanoparticles, can be designed to improve the pharmacokinetics and biodistribution of the drug. However, the pharmacokinetics and pharmacodynamics of nanomedicine is highly variable among different patients. When designed to avoid the body's defence mechanisms, nanoparticles have beneficial properties that can be used to improve drug delivery. Complex drug delivery mechanisms are being developed, including the ability to get drugs through cell membranes and into cell cytoplasm. Triggered response is one way for drug molecules to be used more efficiently. Drugs are placed in the body and only activate on encountering a particular signal. For example, a drug with poor solubility will be replaced by a drug delivery system where both hydrophilic and hydrophobic environments exist, improving the solubility. Drug delivery systems may also be able to prevent tissue damage through regulated drug release; reduce drug clearance rates; or lower the volume of distribution and reduce the effect on non-target tissue. However, the biodistribution of these nanoparticles is still imperfect due to the complex host's reactions to nano- and microsized materials and the difficulty in targeting specific organs in the body. Nevertheless, a lot of work is still ongoing to optimize and better understand the potential and limitations of nanoparticulate systems. While advancement of research proves that targeting and distribution can be augmented by nanoparticles, the dangers of nanotoxicity become an important next step in further understanding of their medical uses. The toxicity of nanoparticles varies, depending on size, shape, and material. These factors also affect the build-up and organ damage that may occur. Nanoparticles are made to be long-lasting, but this causes them to be trapped within organs, specifically the liver and spleen, as they cannot be broken down or excreted. This build-up of non-biodegradable material has been observed to cause organ damage and inflammation in mice. Magnetic targeted delivery of magnetic nanoparticles to the tumor site under the influence of inhomogeneous stationary magnetic fields may lead to enhanced tumor growth. In order to circumvent the pro-tumorigenic effects, alternating electromagnetic fields should be used.

Nanoparticles are under research for their potential to decrease antibiotic resistance or for various antimicrobial uses. Nanoparticles might also be used to circumvent multidrug resistance (MDR) mechanisms.

Systems under research

Advances in lipid nanotechnology were instrumental in engineering medical nanodevices and novel drug delivery systems, as well as in developing sensing applications. Another system for microRNA delivery under preliminary research is nanoparticles formed by the self-assembly of two different microRNAs deregulated in cancer. One potential application is based on small electromechanical systems, such as nanoelectromechanical systems being investigated for the active release of drugs and sensors for possible cancer treatment with iron nanoparticles or gold shells.

Applications

Some nanotechnology-based drugs that are commercially available or in human clinical trials include:

  • Abraxane, approved by the U.S. Food and Drug Administration (FDA) to treat breast cancer, non-small- cell lung cancer (NSCLC) and pancreatic cancer, is the nanoparticle albumin bound paclitaxel.
  • Doxil was originally approved by the FDA for the use on HIV-related Kaposi's sarcoma. It is now being used to also treat ovarian cancer and multiple myeloma. The drug is encased in liposomes, which helps to extend the life of the drug that is being distributed. Liposomes are self-assembling, spherical, closed colloidal structures that are composed of lipid bilayers that surround an aqueous space. The liposomes also help to increase the functionality and it helps to decrease the damage that the drug does to the heart muscles specifically.
  • Onivyde, liposome encapsulated irinotecan to treat metastatic pancreatic cancer, was approved by FDA in October 2015.
  • Rapamune is a nanocrystal-based drug that was approved by the FDA in 2000 to prevent organ rejection after transplantation. The nanocrystal components allow for increased drug solubility and dissolution rate, leading to improved absorption and high bioavailability.
  • Cabenuva is approved by FDA as cabotegravir extended-release injectable nano-suspension, plus rilpivirine extended-release injectable nano-suspension. It is indicated as a complete regimen for the treatment of HIV-1 infection in adults to replace the current antiretroviral regimen in those who are virologically suppressed (HIV-1 RNA less than 50 copies per mL) on a stable antiretroviral regimen with no history of treatment failure and with no known or suspected resistance to either cabotegravir or rilpivirine. This is the first FDA-approved injectable, complete regimen for HIV-1 infected adults that is administered once a month.

Imaging

In vivo imaging is another area where tools and devices are being developed. Using nanoparticle contrast agents, images such as ultrasound and MRI have a favorable distribution and improved contrast. In cardiovascular imaging, nanoparticles have potential to aid visualization of blood pooling, ischemia, angiogenesis, atherosclerosis, and focal areas where inflammation is present.

The small size of nanoparticles endows them with properties that can be very useful in oncology, particularly in imaging. Quantum dots (nanoparticles with quantum confinement properties, such as size-tunable light emission), when used in conjunction with MRI (magnetic resonance imaging), can produce exceptional images of tumor sites. Nanoparticles of cadmium selenide (quantum dots) glow when exposed to ultraviolet light. When injected, they seep into cancer tumors. The surgeon can see the glowing tumor, and use it as a guide for more accurate tumor removal. These nanoparticles are much brighter than organic dyes and only need one light source for excitation. This means that the use of fluorescent quantum dots could produce a higher contrast image and at a lower cost than today's organic dyes used as contrast media. The downside, however, is that quantum dots are usually made of quite toxic elements, but this concern may be addressed by use of fluorescent dopants.

Tracking movement can help determine how well drugs are being distributed or how substances are metabolized. It is difficult to track a small group of cells throughout the body, so scientists used to dye the cells. These dyes needed to be excited by light of a certain wavelength in order for them to light up. While different color dyes absorb different frequencies of light, there was a need for as many light sources as cells. A way around this problem is with luminescent tags. These tags are quantum dots attached to proteins that penetrate cell membranes. The dots can be random in size, can be made of bio-inert material, and they demonstrate the nanoscale property that color is size-dependent. As a result, sizes are selected so that the frequency of light used to make a group of quantum dots fluoresce is an even multiple of the frequency required to make another group incandesce. Then both groups can be lit with a single light source. They have also found a way to insert nanoparticles into the affected parts of the body so that those parts of the body will glow showing the tumor growth or shrinkage or also organ trouble.

Sensing

Nanotechnology-on-a-chip is one more dimension of lab-on-a-chip technology. Magnetic nanoparticles, bound to a suitable antibody, are used to label specific molecules, structures or microorganisms. In particular silica nanoparticles are inert from the photophysical point of view and might accumulate a large number of dye(s) within the nanoparticle shell. Gold nanoparticles tagged with short segments of DNA can be used for detection of genetic sequence in a sample. Multicolor optical coding for biological assays has been achieved by embedding different-sized quantum dots into polymeric microbeads. Nanopore technology for analysis of nucleic acids converts strings of nucleotides directly into electronic signatures.

Sensor test chips containing thousands of nanowires, able to detect proteins and other biomarkers left behind by cancer cells, could enable the detection and diagnosis of cancer in the early stages from a few drops of a patient's blood. Nanotechnology is helping to advance the use of arthroscopes, which are pencil-sized devices that are used in surgeries with lights and cameras so surgeons can do the surgeries with smaller incisions. The smaller the incisions the faster the healing time which is better for the patients. It is also helping to find a way to make an arthroscope smaller than a strand of hair.

Research on nanoelectronics-based cancer diagnostics could lead to tests that can be done in pharmacies. The results promise to be highly accurate and the product promises to be inexpensive. They could take a very small amount of blood and detect cancer anywhere in the body in about five minutes, with a sensitivity that is a thousand times better a conventional laboratory test. These devices that are built with nanowires to detect cancer proteins; each nanowire detector is primed to be sensitive to a different cancer marker. The biggest advantage of the nanowire detectors is that they could test for anywhere from ten to one hundred similar medical conditions without adding cost to the testing device. Nanotechnology has also helped to personalize oncology for the detection, diagnosis, and treatment of cancer. It is now able to be tailored to each individual's tumor for better performance. They have found ways that they will be able to target a specific part of the body that is being affected by cancer.

Sepsis treatment

In contrast to dialysis, which works on the principle of the size related diffusion of solutes and ultrafiltration of fluid across a semi-permeable membrane, the purification with nanoparticles allows specific targeting of substances. Additionally larger compounds which are commonly not dialyzable can be removed.he purification process is based on functionalized iron oxide or carbon coated metal nanoparticles with ferromagnetic or superparamagnetic properties. Binding agents such as proteins, antibiotics, or synthetic ligands are covalently linked to the particle surface. These binding agents are able to interact with target species forming an agglomerate. Applying an external magnetic field gradient allows exerting a force on the nanoparticles. Hence the particles can be separated from the bulk fluid, thereby cleaning it from the contaminants.

The small size (< 100 nm) and large surface area of functionalized nanomagnets leads to advantageous properties compared to hemoperfusion, which is a clinically used technique for the purification of blood and is based on surface adsorption. These advantages are high loading and accessible for binding agents, high selectivity towards the target compound, fast diffusion, small hydrodynamic resistance, and low dosage.

Tissue engineering

Nanotechnology may be used as part of tissue engineering to help reproduce or repair or reshape damaged tissue using suitable nanomaterial-based scaffolds and growth factors. Tissue engineering if successful may replace conventional treatments like organ transplants or artificial implants. Nanoparticles such as graphene, carbon nanotubes, molybdenum disulfide and tungsten disulfide are being used as reinforcing agents to fabricate mechanically strong biodegradable polymeric nanocomposites for bone tissue engineering applications. The addition of these nanoparticles in the polymer matrix at low concentrations (~0.2 weight %) leads to significant improvements in the compressive and flexural mechanical properties of polymeric nanocomposites. Potentially, these nanocomposites may be used as a novel, mechanically strong, light weight composite as bone implants.

For example, a flesh welder was demonstrated to fuse two pieces of chicken meat into a single piece using a suspension of gold-coated nanoshells activated by an infrared laser. This could be used to weld arteries during surgery. Another example is nanonephrology, the use of nanomedicine on the kidney.

Medical devices

Neuro-electronic interfacing is a visionary goal dealing with the construction of nanodevices that will permit computers to be joined and linked to the nervous system. This idea requires the building of a molecular structure that will permit control and detection of nerve impulses by an external computer. A refuelable strategy implies energy is refilled continuously or periodically with external sonic, chemical, tethered, magnetic, or biological electrical sources, while a non-refuelable strategy implies that all power is drawn from internal energy storage which would stop when all energy is drained. A nanoscale enzymatic biofuel cell for self-powered nanodevices have been developed that uses glucose from biofluids including human blood and watermelons. One limitation to this innovation is the fact that electrical interference or leakage or overheating from power consumption is possible. The wiring of the structure is extremely difficult because they must be positioned precisely in the nervous system. The structures that will provide the interface must also be compatible with the body's immune system.

Cell repair machines

Molecular nanotechnology is a speculative subfield of nanotechnology regarding the possibility of engineering molecular assemblers, machines which could re-order matter at a molecular or atomic scale.[citation needed] Nanomedicine would make use of these nanorobots, introduced into the body, to repair or detect damages and infections. Molecular nanotechnology is highly theoretical, seeking to anticipate what inventions nanotechnology might yield and to propose an agenda for future inquiry. The proposed elements of molecular nanotechnology, such as molecular assemblers and nanorobots are far beyond current capabilities. Future advances in nanomedicine could give rise to life extension through the repair of many processes thought to be responsible for aging. K. Eric Drexler, one of the founders of nanotechnology, postulated cell repair machines, including ones operating within cells and utilizing as yet hypothetical molecular machines, in his 1986 book Engines of Creation, with the first technical discussion of medical nanorobots by Robert Freitas appearing in 1999. Raymond Kurzweil, a futurist and transhumanist, stated in his book The Singularity Is Near that he believes that advanced medical nanorobotics could completely remedy the effects of aging by 2030. According to Richard Feynman, it was his former graduate student and collaborator Albert Hibbs who originally suggested to him (circa 1959) the idea of a medical use for Feynman's theoretical micromachines (see nanotechnology). Hibbs suggested that certain repair machines might one day be reduced in size to the point that it would, in theory, be possible to (as Feynman put it) "swallow the doctor". The idea was incorporated into Feynman's 1959 essay There's Plenty of Room at the Bottom.

Unitarian Universalism

From Wikipedia, the free encyclopedia https://en.wikipedia.org/wiki/Unitaria...