Search This Blog

Monday, February 2, 2015

Telomeres / Life Extension


From Wikipedia, the free encyclopedia


Human chromosomes (grey) capped by telomeres (white)

Telomere

A telomere is a region of repetitive nucleotide sequences at each end of a chromatid, which protects the end of the chromosome from deterioration or from fusion with neighbouring chromosomes. Its name is derived from the Greek nouns telos (τέλος) 'end' and merοs (μέρος, root: μερ-) 'part.' For vertebrates, the sequence of nucleotides in telomeres is TTAGGG.

During chromosome replication, the enzymes that duplicate DNA cannot continue their duplication all the way to the end of a chromosome, so in each duplication the end of the chromosome is shortened[1] (this is because the synthesis of Okazaki fragments requires RNA primers attaching ahead on the lagging strand). The telomeres are disposable buffers at the ends of chromosomes which are truncated during cell division; their presence protects the genes before them on the chromosome from being truncated instead.

Over time, due to each cell division, the telomere ends become shorter.[2] They are replenished by an enzyme, telomerase reverse transcriptase.

Discovery

In the early 1970s, Russian theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends. Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell/DNA replicates until the loss reaches a critical level, at which point cell division ends.[3][4] However, Olovnikov's prediction was not widely known except by a handful of researchers studying cellular aging and immortalization.[5]

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Their work was published in 1978.[6] Elizabeth Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.[7]

Nevertheless, in the 1970s there was no recognition that the telomere-shortening mechanism normally limits cells to a fixed number of divisions, or animal studies suggesting that this is responsible for aging on the cellular level and sets a limit on lifespans.[8][9]

It remained for a privately funded collaboration from biotechnology company Geron to isolate the genes for the RNA and protein component of human telomerase in order to establish the causal role of telomere shortening in cellular aging and telomerase reactivation in cell immortalization.[10]

Nature and function

Structure, function and evolutionary biology

Telomeres are repetitive nucleotide sequences located at the termini of linear chromosomes of most eukaryotic organisms. For vertebrates, the sequence of nucleotides in telomeres is TTAGGG. Most prokaryotes, lacking this linear arrangement, do not have telomeres. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. A protein complex known as shelterin serves as protection against double-strand break (DSB) repair by homologous recombination (HR) and non-homologous end joining (NHEJ).[11][12]

Three-dimensional representation of the molecular structure of a telomere (G-quadruplex)

In most prokaryotes, chromosomes are circular and, thus, do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.[13]

While replicating DNA, the eukaryotic DNA replication enzymes (the DNA polymerase protein complex) cannot replicate the sequences present at the ends of the chromosomes (or more precisely the chromatid fibres). Hence, these sequences and the information they carry may get lost. This is the reason telomeres are so important in context of successful cell division: They "cap" the end-sequences and themselves get lost in the process of DNA replication. But the cell has an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase, thus, "replenishes" the telomere "cap" of the DNA. In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be re activated and telomeres reset back to an embryonic state by somatic cell nuclear transfer.[14] There are theories that claim that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Telomere length varies greatly between species, from approximately 300 base pairs in yeast[15] to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified.[16] These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle stabilized by telomere-binding proteins.[17] At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.[18]

Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility.[19] If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence), or begin programmed cell self-destruction (apoptosis) depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

At the very distal end of the telomere is a 300 bp single-stranded portion, which forms the T-Loop. This loop is analogous to a knot, which stabilizes the telomere, preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by several proteins, the most notable ones being TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1.[11]

Cancer, telomerase and ALT (alternative lengthening of telomeres)

Malignant cells that bypass this arrest become immortalized by telomere extension due mostly to the activation of telomerase (the reverse transcriptase enzyme responsible for synthesis of telomeres). Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence that acts to protect the terminal ends of chromosomes from being broken down by enzymes. The telomeres (and the actions of telomerase) are necessary because, during replication, DNA polymerase can synthesize DNA in only a 5' to 3' direction (each DNA strand having a polarity that is determined by the precise manner in which sugar molecules of the strand's "backbone" are linked together) and can do so only by adding nucleotides to RNA primers (that have already been placed at various points along the length of the DNA). The RNA strands are replaced with newly synthesized DNA, but DNA polymerase can only "backfill" deoxyribonucleotides if there is already DNA "upstream" from (i.e., located 5' to) the RNA primer. At the chromosome terminal, however, there is no nucleotide sequence in the 5' direction (and therefore no upstream RNA primer or DNA), so DNA polymerase cannot function and genetic sequence might be lost through chromosomal fraying.
Chromosomal ends might also be processed as breaks in double-strand DNA with chromosome-to-chromosome telomere fusions resulting.

Telomeres at the end of DNA prevent the chromosome from growing shorter during replications (with loss of genetic information) by employing "telomerases" to synthesize DNA at the chromosome terminal. These include a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) and are involved in synthesis of telomeres in humans and many other, but not all, organisms. Because DNA replication mechanisms are affected by oxidative stress and because TERT expression is very low in most types of human cell, telomeres shrink a little bit every time a cell divides. Among cell types characterized by extensive cell division (such as stem cells and certain white blood cells), however, TERT is expressed at higher levels and telomere shortening is partially or fully prevented.

Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but, in general, one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other, with either a sodium or a potassium ion between the planar quadruplexes.

Mammalian (and other) somatic cells without telomerase gradually lose telomeric sequences as a result of incomplete replication (Counter et al., 1992). As mammalian telomeres shorten, eventually cells reach their replicative limit and progress into senescence or old age. Senescence involves p53 and pRb pathways and leads to the halting of cell proliferation (Campisi, 2005). Senescence may play an important role in suppression of cancer emergence, although inheriting shorter telomeres probably does not protect against cancer.[19] With critically shortened telomeres, further cell proliferation can be achieved by inactivation of p53 and pRb pathways. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die.

However, 5–10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway, which relies on recombination-mediated elongation.[20] Rarely, cells emerge from crisis immortalized through telomere lengthening by either activated telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). The first description of an ALT cell line demonstrated that their telomeres are highly heterogeneous in length and predicted a mechanism involving recombination (Murnane et al., 1994). Subsequent studies have confirmed a role for recombination in telomere maintenance by ALT (Dunham et al., 2000), however the exact mechanism of this pathway is yet to be determined. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution (Tomaska et al., 2000; 2009; Cesare and Griffith, 2004; Wang et al., 2004).

Since shorter telomeres are thought to be a cause of poorer health and aging, this raises the question of why longer telomeres are not selected for to ameliorate these effects. A prominent explanation suggests that inheriting longer telomeres would cause increased cancer rates (e.g. Weinstein and Ciszek, 2002). However, a recent literature review and analysis [19] suggests this is unlikely, because shorter telomeres and telomerase inactivation is more often associated with increased cancer rates, and the mortality from cancer occurs late in life when the force of natural selection is very low. An alternative explanation to the hypothesis that long telomeres are selected against due to their cancer promoting effects is the "thrifty telomere" hypothesis, which suggests that the cellular proliferation effects of longer telomeres causes increased energy expenditures.[19] In environments of energetic limitation, shorter telomeres might be an energy sparing mechanism.

In healthy female breast, a proportion of cells called luminal progenitors that line the milk ducts have proliferative and differentiation potential and most of them contain critically short telomeres with DNA damage foci. These cells are believed to be the possible common cellular loci where cancers of the breast involving telomere dysregulation may arise.[21] The telomere shortening in these progenitors is not age dependent but is speculated to be basal to luminal epithelial differentiation program-dependent. Also, the telomerase activity are unusually high in these cells when isolated from younger women but decline with age.[22]

Shortening


Lagging strand during DNA replication

Telomeres shorten in part because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all known DNA polymerases move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a short distance ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease, and DNA ligase come along to convert the RNA (of the primers) to DNA and to seal the gaps in between the Okazaki fragments. But, in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it does not happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade any RNA left on the DNA. Thus, a section of the telomere is lost during each cycle of replication at the 5' end of the lagging strand's daughter.

However, in vitro studies have shown that telomeres are highly susceptible to oxidative stress, and Richter and Zglinicki presented evidence that oxidative stress-mediated DNA damage is an important determinant of telomere shortening.[23] Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (ca. 20 bp) and actual telomere shortening rates (50–100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem. Population-based studies have also indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E.[24] These results suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

Telomere shortening is associated with ageing, mortality and ageing-related diseases. In 2003, Richard Cawthon discovered that those with longer telomeres lead longer lives than those with short telomeres.[25] However, it is not known whether short telomeres are just a sign of cellular age or actually contribute to the aging process.[citation needed]

Lengthening

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit.[26][27] Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West that tied telomere shortening with the Hayflick limit. This team included Calvin Harley, Bryant Villeponteau, Gregg Morin, William Andrews, Karen Chapman, as well as collaborators at the University of Colorado and the University of Texas Southwestern Medical Center at Dallas.[28] The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.[29]

It is becoming apparent that reversing shortening of telomeres through temporary activation of telomerase may be a potent means to slow aging. They reason that this would extend human life because it would extend the Hayflick limit. Three routes have been proposed to reverse telomere shortening: drugs, gene therapy, or metabolic suppression, so-called, torpor/hibernation. So far these ideas have not been proven in humans, but it has been demonstrated that telomere shortening is reversed in hibernation and aging is slowed (Turbill, et al. 2012 & 2013) and that hibernation prolongs life-span (Lyman et al. 1981). It has also been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice [30][31] and the nematode worm species Caenorhabditis elegans.[32] It has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer (e.g. Weinstein and Ciszek, 2002). However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption.[19]

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Two recent studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood . In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.[33] In 2006, Juola et al.[34] reported that in another unrelated, long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

Furthermore, Gomes et al. found, in a study of the comparative biology of mammalian telomeres, that telomere length of different mammalian species correlates inversely, rather than directly, with lifespan, and they concluded that the contribution of telomere length to lifespan remains controversial.[35] Harris et al. found little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities.[36] Gilley and Blackburn tested whether cellular senescence in paramecium is caused by telomere shortening, and found that telomeres were not shortened during senescence.[37]

Sequences

Known, up-to-date telomere nucleotide sequences are listed in Telomerase Database website.

Some known telomere nucleotide sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Cancer

Telomeres are critical for maintaining genomic integrity and studies show that telomere dysfunction or shortening is commonly acquired during the process of tumor development.[38] Short telomeres can lead to genomic instability, chromosome loss and the formation of non-reciprocal translocations; and telomeres in tumor cells and their precursor lesions are significantly shorter than surrounding normal tissue.[39][40]

Observational studies have found shortened telomeres in many cancers: including pancreatic, bone, prostate, bladder, lung, kidney, and head and neck. In addition, people with many types of cancer have been found to possess shorter leukocyte telomeres than healthy controls.[41] Recent meta-analyses suggest 1.4 to 3.0 fold increased risk of cancer for those with the shortest vs. longest telomeres.[42][43] However the increase risk varies by age, sex, tumor type and differences in lifestyle factors.

Some of the same lifestyle factors which increase risk of developing cancer have also been associated with shortened telomeres: including smoking, physical inactivity and diet high in refined sugars [44] Diet and physical activity influence inflammation and oxidative stress. These factors are known to influence telomere maintenance.[45] Psychologic stress has also been linked to accelerated cell aging, as reflected by decreased telomerase activity and short telomeres.[46] It has been suggested that a combination of lifestyle modifications, including healthy diet, exercise and stress reduction, have the potential to increase telomere length, reverse cellular aging, and reduce the risk for aging-related diseases. In a recent clinical trial for early-stage prostate cancer patients, comprehensive lifestyle changes resulted in a short-term increase in telomerase activity and long-term modification in telomere length.[47][48] Lifestyle modifications have the potential to naturally regulate telomere maintenance without promoting tumorgenesis, as traditional mechanisms of telomere lengthening involve the use of telomerase activating agents.

Cancer cells require a mechanism to maintain their telomeric DNA in order to continue dividing indefinitely (immortalization). A mechanism for telomere elongation or maintenance is one of the key steps in cellular immortalization and can be used as a diagnostic marker in the clinic. Telomerase, the enzyme complex responsible for elongating telomeres, is activated in approximately 90% of tumors. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT),[49] a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids.[50]

Telomerase is the natural enzyme that promotes telomere repair. It is active in stem cells, germ cells, hair follicles, and 90 percent of cancer cells, but its expression is low or absent in somatic cells. Telomerase functions by adding bases to the ends of the telomeres. Cells with sufficient telomerase activity are considered immortal in the sense that they can divide past the Hayflick limit without entering senescence or apoptosis. For this reason, telomerase is viewed as a potential target for anti-cancer drugs (such as Geron's Imetelstat currently in human clinical trials and telomestatin).[51]

Studies using knockout mice have demonstrated that the role of telomeres in cancer can both be limiting to tumor growth, as well as promote tumorigenesis, depending on the cell type and genomic context.[52][53]

Measurement

Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot,[54] which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method, termed Q-FISH, involves fluorescent in situ hybridization (FISH).[55] Q-FISH, however, requires significant amounts of genomic DNA (2-20 micrograms) and labor that renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length and Flow-FISH. Real-time PCR assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio,[56] which is demonstrated to be proportional to the average telomere length in a cell.

Another technique, referred to as single telomere elongation length analysis (STELA), was developed in 2003 by Duncan Baird. This technique allows investigations that can target specific telomere ends, which is not possible with TRF analysis. However, due to this technique's being PCR-based, telomeres larger than 25Kb cannot be amplified and there is a bias towards shorter telomeres.

Telomere length is associated with the general health of an individual as well as certain diseases, beyond cancer.[57][58] While multiple companies offer telomere length measurement services,[59][60] the utility of these measurements for widespread clinical or personal use has been questioned by prominent scientists without financial interests in these companies.[61][62] Nobel Prize winner Elizabeth Blackburn, who was the co-founder of one of these companies and has prominently promoted the clinical utility of telomere length measures,[63] resigned from the company in June 2013 "owing to an impending change in the control of Telome Health".[64]

Future of an expanding universe


From Wikipedia, the free encyclopedia

Observations suggest that the expansion of the universe will continue forever. If so, the Universe will cool as it expands, eventually becoming too cold to sustain life. For this reason, this future scenario is popularly called the Big Freeze.[1]

If dark energy—represented by the cosmological constant, a constant energy density filling space homogeneously,[2] or scalar fields, such as quintessence or moduli, dynamic quantities whose energy density can vary in time and space—accelerates the expansion of the Universe, the space between clusters of galaxies will grow at an increasing rate. Redshift will stretch ancient, incoming photons (even gamma rays) to undetectably long wavelengths and low energies.[3] Stars are expected to form normally for 1012 to 1014 (1–100 trillion) years, but eventually the supply of gas needed for star formation will be exhausted. And as existing stars run out of fuel and cease to shine, the Universe will slowly and inexorably grow darker, one star at a time.[4] §IID, [5] According to theories that predict proton decay, the stellar remnants left behind will disappear, leaving behind only black holes, which themselves eventually disappear as they emit Hawking radiation.[6] Ultimately, if the Universe reaches a state in which the temperature approaches a uniform value, no further work will be possible, resulting in a final heat death of the universe.[7]

Cosmology

Infinite expansion does not determine the spatial curvature of the Universe. It can be open (with negative spatial curvature), flat, or closed (positive spatial curvature), although if it is closed, sufficient dark energy must be present to counteract the gravitational attraction of matter and other forces tending to contract the Universe. Open and flat universes will expand forever even in the absence of dark energy.[8]

Observations of the cosmic background radiation by the Wilkinson Microwave Anisotropy Probe suggest that the Universe is spatially flat and has a significant amount of dark energy.[9] In this case, the Universe should continue to expand at an accelerating rate. The acceleration of the Universe's expansion has also been confirmed by observations of distant supernovae.[8] If, as in the concordance model of physical cosmology (Lambda-cold dark matter or ΛCDM), the dark energy is in the form of a cosmological constant, the expansion will eventually become exponential, with the size of the Universe doubling at a constant rate.

If the theory of inflation is true, the Universe went through an episode dominated by a different form of dark energy in the first moments of the big bang; but inflation ended, indicating an equation of state much more complicated than those assumed so far for present-day dark energy. It is possible that the dark energy equation of state could change again resulting in an event that would have consequences which are extremely difficult to parametrize or predict.[citation needed]

Future history

In the 1970s, the future of an expanding universe was studied by the astrophysicist Jamal Islam[10] and the physicist Freeman Dyson.[11] Then, in their 1999 book The Five Ages of the Universe, the astrophysicists Fred Adams and Gregory Laughlin have divided the past and future history of an expanding universe into five eras. The first, the Primordial Era, is the time in the past just after the Big Bang when stars had not yet formed. The second, the Stelliferous Era, includes the present day and all of the stars and galaxies we see. It is the time during which stars form from collapsing clouds of gas. In the subsequent Degenerate Era, the stars will have burnt out, leaving all stellar-mass objects as stellar remnantswhite dwarfs, neutron stars, and black holes. In the Black Hole Era, white dwarfs, neutron stars, and other smaller astronomical objects have been destroyed by proton decay, leaving only black holes. Finally, in the Dark Era, even black holes have disappeared, leaving only a dilute gas of photons and leptons.[12], pp. xxiv–xxviii.

This future history and the timeline below assume the continued expansion of the Universe. If the Universe begins to recontract, subsequent events in the timeline may not occur because the Big Crunch, the recontraction of the Universe into a hot, dense state similar to that after the Big Bang, will supervene.[12], pp. 190–192;[13]

Timeline

Stelliferous Era

From 106 (1 million) years to 1014 (100 trillion) years after the Big Bang
The observable universe is currently 1.38×1010 (13.8 billion) years old.[14] This time is in the Stelliferous Era. About 155 million years after the Big Bang, the first star formed. Since then, stars have formed by the collapse of small, dense core regions in large, cold molecular clouds of hydrogen gas. At first, this produces a protostar, which is hot and bright because of energy generated by gravitational contraction. After the protostar contracts for a while, its center will become hot enough to fuse hydrogen and its lifetime as a star will properly begin.[12], pp. 35–39.
Stars of very low mass will eventually exhaust all their fusible hydrogen and then become helium white dwarfs.[15] Stars of low to medium mass will expel some of their mass as a planetary nebula and eventually become white dwarfs; more massive stars will explode in a core-collapse supernova, leaving behind neutron stars or black holes.[16] In any case, although some of the star's matter may be returned to the interstellar medium, a degenerate remnant will be left behind whose mass is not returned to the interstellar medium. Therefore, the supply of gas available for star formation is steadily being exhausted.

Milky Way Galaxy and the Andromeda Galaxy merge into one

5 billion years from now (18.7 billion years after the Big Bang)
The Andromeda Galaxy is currently approximately 2.5 million light years away from our galaxy, the Milky Way Galaxy, and they are moving towards each other at approximately 300 kilometers (186 miles) per second. Approximately five billion years from now, or 19 billion years after the Big Bang, the Milky Way and the Andromeda Galaxy will collide with one another and merge into one large galaxy based on current evidence. Up until 2012, there was no way to know whether the possible collision was definitely going to happen or not.[17] In 2012, researchers came to the conclusion that the collision is definite after using the Hubble Space Telescope between 2002 and 2010 to track the motion of Andromeda.[18]

Coalescence of Local Group and galaxies outside the Local Group are no longer accessible

1011 (100 billion) to 1012 (1 trillion) years
The galaxies in the Local Group, the cluster of galaxies which includes the Milky Way and the Andromeda Galaxy, are gravitationally bound to each other. It is expected that between 1011 (100 billion) and 1012 (1 trillion) years from now, their orbits will decay and the entire Local Group will merge into one large galaxy.[4], §IIIA.

Assuming that dark energy continues to make the Universe expand at an accelerating rate, in about 150 billion years all galaxies outside the local group will pass behind the cosmological horizon. It will then be impossible for events in the local group to affect other galaxies. Similarly it will be impossible for events after 150 billion years, as seen by observers in distant galaxies, to affect events in the local group.[3] However, an observer in the local group will continue to see distant galaxies, but events they observe will become exponentially more time dilated (and red shifted[3]) as the galaxy approaches the horizon until time in the distant galaxy seems to stop. The observer in the local group never actually sees the distant galaxy pass beyond the horizon and never observes events after 150 billion years in their local time. Therefore, after 150 billion years intergalactic transportation and communication becomes causally impossible.

Galaxies outside the Local Supercluster are no longer detectable

2×1012 (2 trillion) years
2×1012 (2 trillion) years from now, all galaxies outside the Local Supercluster will be red-shifted to such an extent that even gamma rays they emit will have wavelengths longer than the size of the observable universe of the time. Therefore, these galaxies will no longer be detectable in any way.[3]

Degenerate Era

From 1014 (100 trillion) to 1040 years
By 1014 (100 trillion) years from now, star formation will end, leaving all stellar objects in the form of degenerate remnants. This period, known as the Degenerate Era, will last until the degenerate remnants finally decay.[19]

Star formation ceases

1014 (100 trillion) years
It is estimated that in 1014 (100 trillion) years or less, star formation will end.[4], §IID. The least massive stars take the longest to exhaust their hydrogen fuel (see stellar evolution). Thus, the longest living stars in the Universe are low-mass red dwarfs, with a mass of about 0.08 solar masses (M), which have a lifetime of order 1013 (10 trillion) years.[20] Coincidentally, this is comparable to the length of time over which star formation takes place.[4] §IID. Once star formation ends and the least massive red dwarfs exhaust their fuel, nuclear fusion will cease. The low-mass red dwarfs will cool and become white dwarfs.[15] The only objects remaining with more than planetary mass will be brown dwarfs, with mass less than 0.08 M, and degenerate remnants; white dwarfs, produced by stars with initial masses between about 0.08 and 8 solar masses; and neutron stars and black holes, produced by stars with initial masses over 8 M. Most of the mass of this collection, approximately 90%, will be in the form of white dwarfs.[5] In the absence of any energy source, all of these formerly luminous bodies will cool and become faint.

The universe will become extremely dark after the last star burns out. Even so, there can still be occasional light in the Universe. One of the ways the Universe can be illuminated is if two carbonoxygen white dwarfs with a combined mass of more than the Chandrasekhar limit of about 1.4 solar masses happen to merge. The resulting object will then undergo runaway thermonuclear fusion, producing a Type Ia supernova and dispelling the darkness of the Degenerate Era for a few weeks.[21][22] If the combined mass is not above the Chandrasekhar limit but is larger than the minimum mass to fuse carbon (about 0.9 M), a carbon star could be produced, with a lifetime of around 106 (1 million) years.[12], p. 91 Also, if two helium white dwarfs with a combined mass of at least 0.3 M collide, a helium star may be produced, with a lifetime of a few hundred million years.[12], p. 91 Finally, if brown dwarfs collide with each other, a red dwarf star may be produced which can survive for 1013 (10 trillion) years.[20][21]

Planets fall or are flung from orbits by a close encounter with another star

1015 (1 quadrillion) years
Over time, the orbits of planets will decay due to gravitational radiation, or planets will be ejected from their local systems by gravitational perturbations caused by encounters with another stellar remnant.[23]

Stellar remnants escape galaxies or fall into black holes

1019 to 1020 (10 to 100 quintillion) years
Over time, objects in a galaxy exchange kinetic energy in a process called dynamical relaxation, making their velocity distribution approach the Maxwell–Boltzmann distribution.[24] Dynamical relaxation can proceed either by close encounters of two stars or by less violent but more frequent distant encounters.[25] In the case of a close encounter, two brown dwarfs or stellar remnants will pass close to each other. When this happens, the trajectories of the objects involved in the close encounter change slightly. After a large number of encounters, lighter objects tend to gain kinetic energy while the heavier objects lose it.[12], pp. 85–87

Because of dynamical relaxation, some objects will gain enough energy to reach galactic escape velocity and depart the galaxy, leaving behind a smaller, denser galaxy. Since encounters are more frequent in the denser galaxy, the process then accelerates. The end result is that most objects (90% to 99%) are ejected from the galaxy, leaving a small fraction (maybe 1% to 10%) which fall into the central supermassive black hole.[4], §IIIAD;[12], pp. 85–87

The supermassive black holes are all that remains of galaxies once all protons decay, but even these giants are not immortal.

Nucleons start to decay

>1034 years
The subsequent evolution of the Universe depends on the existence and rate of proton decay
Experimental evidence shows that if the proton is unstable, it has a half-life of at least 1034 years.[26] If any of the Grand Unified theories are correct, then there are theoretical reasons to believe that the half-life of the proton is under 1041 years.[27] Neutrons bound into nuclei are also expected to decay with a half-life comparable to the proton's.[27]
In the event that the proton does not decay at all, stellar-mass objects would still disappear, but more slowly. See Future without proton decay below.

The rest of this timeline assumes that the proton half-life is approximately 1037 years.[27] Shorter or longer proton half-lives will accelerate or decelerate the process. This means that after 1037 years, one-half of all baryonic matter will have been converted into gamma ray photons and leptons through proton decay.

All nucleons decay

1040 years
Given our assumed half-life of the proton, nucleons (protons and bound neutrons) will have undergone roughly 1,000 half-lives by the time the Universe is 1040 years old. To put this into perspective, there are an estimated 1080 protons currently in the universe.[28] This means that the number of nucleons will be slashed in half 1,000 times by the time the Universe is 1040 years old. Hence, there will be roughly ½1,000 (approximately 10−301) as many nucleons remaining as there are today; that is, zero nucleons remaining in the Universe at the end of the Degenerate Age. Effectively, all baryonic matter will have been changed into photons and leptons. Some models predict the formation of stable positronium atoms with a greater diameter than the observable universe's current diameter in 1085 years, and that these will in turn decay to gamma radiation in 10141 years.[4] §IID, [5]

Black Hole Era

1040 years to 10100 years
After 1040 years, black holes will dominate the Universe. They will slowly evaporate via Hawking radiation.[4], §IVG. A black hole with a mass of around 1 M will vanish in around 2×1066 years. As the lifetime of a black hole is proportional to the cube of its mass, more massive black holes take longer to decay. A supermassive black hole with a mass of 1011 (100 billion) M will evaporate in around 2×1099 years.[29]

Hawking radiation has a thermal spectrum. During most of a black hole's lifetime, the radiation has a low temperature and is mainly in the form of massless particles such as photons and hypothetical gravitons. As the black hole's mass decreases, its temperature increases, becoming comparable to the Sun's by the time the black hole mass has decreased to 1019 kilograms. The hole then provides a temporary source of light during the general darkness of the Black Hole Era. During the last stages of its evaporation, a black hole will emit not only massless particles but also heavier particles such as electrons, positrons, protons and antiprotons.[12], pp. 148–150.

If protons do not decay as described above

In the event the proton does not decay as described above, the Degenerate Era will last longer, and will overlap the Black Hole Era. In a timescale of approximately 1065 years, apparently rigid objects such as rocks will be able to rearrange their atoms and molecules via quantum tunnelling, behaving as a liquid does, but more slowly.[11] However, the proton is still expected to decay, for example via processes involving virtual black holes, or other higher-order processes, with a half-life of under 10200 years.[4], §IVF For example, under the Standard Model, groups of 2 or more nucleons are theoretically unstable because chiral anomaly allows processes that change baryon number by a multiple of 3.

Dark Era and Photon Age

From 10100 years

The lonely photon is now king of the universe as the last of the supermassive black holes evaporates.

After all the black holes have evaporated (and after all the ordinary matter made of protons has disintegrated, if protons are unstable), the Universe will be nearly empty. Photons, neutrinos, electrons, and positrons will fly from place to place, hardly ever encountering each other. Gravitationally, the Universe will be dominated by dark matter, electrons, and positrons (not protons).[30]

By this era, with only very diffuse matter remaining, activity in the Universe will have tailed off dramatically (compared with previous eras), with very low energy levels and very large time scales. Electrons and positrons drifting through space will encounter one another and occasionally form positronium atoms. These structures are unstable, however, and their constituent particles must eventually annihilate.[31] Other low-level annihilation events will also take place, albeit very slowly. The Universe now reaches an extremely low-energy state.

Beyond

What happens after this is speculative. It is possible that a Big Rip event may occur far off into the future. Also, the Universe may enter a second inflationary epoch, or, assuming that the current vacuum state is a false vacuum, the vacuum may decay into a lower-energy state.[32]

Presumably, extreme low-energy states imply that localized quantum events become major macroscopic phenomena rather than negligible microscopic events because the smallest perturbations make the biggest difference in this era, so there is no telling what may happen to space or time. It is perceived that the laws of "macro-physics" will break down, and the laws of "quantum-physics" will prevail.[7]

The universe could possibly avoid eternal heat death through quantum fluctuations, which could produce a new Big Bang in roughly 10^{10^{56}} years.[33]

Over an infinite time there could be a spontaneous entropy decrease, by a Poincaré recurrence or through thermal fluctuations (see also fluctuation theorem).[34][35][36][37]

Future without proton decay

If the proton does not decay, stellar-mass objects will still become black holes, but more slowly. The following timeline assumes that proton decay does not take place.

Matter decays into iron

101500 years from now
In 101500 years, cold fusion occurring via quantum tunnelling should make the light nuclei in ordinary matter fuse into iron-56 nuclei (see isotopes of iron.) Fission and alpha-particle emission should make heavy nuclei also decay to iron, leaving stellar-mass objects as cold spheres of iron, called iron stars.[11]

Collapse of iron star to black hole

10^{10^{26}} to 10^{10^{76}} years from now
Quantum tunnelling should also turn large objects into black holes. Depending on the assumptions made, the time this takes to happen can be calculated as from 10^{10^{26}} years to 10^{10^{76}} years. Quantum tunnelling may also make iron stars collapse into neutron stars in around 10^{10^{76}} years.[11]

Graphical timeline

Logarithmic scale

Uses of open science

From Wikipedia, the free encyclopedia https://en.wikipedia.org/wiki/Uses_of_open_science   The op...