Search This Blog

Thursday, June 13, 2024

Interferon

From Wikipedia, the free encyclopedia
Interferon type I (α/β/δ...)
The molecular structure of human interferon-alpha (PDB: 1RH2​)
Identifiers
SymbolInterferons
PfamPF00143
InterProIPR000471
SMARTSM00076
PROSITEPDOC00225
CATH1au0
SCOP21au1 / SCOPe / SUPFAM
CDDcd00095

Available protein structures:
Interferon type II (γ)
The three-dimensional structure of human interferon gamma (PDB: 1HIG​)
Identifiers
SymbolIFN-gamma
PfamPF00714
InterProIPR002069
CATH1d9cA00
SCOP2d1d9ca_ / SCOPe / SUPFAM

Available protein structures:
Interferon type III (λ)
Identifiers
SymbolIL28A
PfamPF15177
InterProIPR029177
CATH3og6A00

Available protein structures:

Interferons (IFNs, /ˌɪntərˈfɪərɒn/ IN-tər-FEER-on) are a group of signaling proteins made and released by host cells in response to the presence of several viruses. In a typical scenario, a virus-infected cell will release interferons causing nearby cells to heighten their anti-viral defenses.

IFNs belong to the large class of proteins known as cytokines, molecules used for communication between cells to trigger the protective defenses of the immune system that help eradicate pathogens. Interferons are named for their ability to "interfere" with viral replication by protecting cells from virus infections. However, virus-encoded genetic elements have the ability to antagonize the IFN response, contributing to viral pathogenesis and viral diseases. IFNs also have various other functions: they activate immune cells, such as natural killer cells and macrophages, and they increase host defenses by up-regulating antigen presentation by virtue of increasing the expression of major histocompatibility complex (MHC) antigens. Certain symptoms of infections, such as fever, muscle pain and "flu-like symptoms", are also caused by the production of IFNs and other cytokines.

More than twenty distinct IFN genes and proteins have been identified in animals, including humans. They are typically divided among three classes: Type I IFN, Type II IFN, and Type III IFN. IFNs belonging to all three classes are important for fighting viral infections and for the regulation of the immune system.

Types of interferon

Based on the type of receptor through which they signal, human interferons have been classified into three major types.

  • Interferon type I: All type I IFNs bind to a specific cell surface receptor complex known as the IFN-α/β receptor (IFNAR) that consists of IFNAR1 and IFNAR2 chains. The type I interferons present in humans are IFN-α, IFN-β, IFN-ε, IFN-κ and IFN-ω. Interferon beta (IFN-β) can be produced by all nucleated cells when they recognize that a virus has invaded them. The most prolific producers of IFN-α and IFN-β are plasmacytoid dendritic cells circulating in the blood. Monocytes and macrophages can also produce large amounts of type I interferons when stimulated by viral molecular patterns. The production of type I IFN-α is inhibited by another cytokine known as Interleukin-10. Once released, type I interferons bind to the IFN-α/β receptor on target cells, which leads to expression of proteins that will prevent the virus from producing and replicating its RNA and DNA. Overall, IFN-α can be used to treat hepatitis B and C infections, while IFN-β can be used to treat multiple sclerosis.
  • Interferon type II (IFN-γ in humans): This is also known as immune interferon and is activated by Interleukin-12. Type II interferons are also released by cytotoxic T cells and type-1 T helper cells. However, they block the proliferation of type-2 T helper cells. The previous results in an inhibition of Th2 immune response and a further induction of Th1 immune response. IFN type II binds to IFNGR, which consists of IFNGR1 and IFNGR2 chains.
  • Interferon type III: Signal through a receptor complex consisting of IL10R2 (also called CRF2-4) and IFNLR1 (also called CRF2-12). Although discovered more recently than type I and type II IFNs, recent information demonstrates the importance of Type III IFNs in some types of virus or fungal infections.

In general, type I and II interferons are responsible for regulating and activating the immune response. Expression of type I and III IFNs can be induced in virtually all cell types upon recognition of viral components, especially nucleic acids, by cytoplasmic and endosomal receptors, whereas type II interferon is induced by cytokines such as IL-12, and its expression is restricted to immune cells such as T cells and NK cells.

Function

All interferons share several common effects: they are antiviral agents and they modulate functions of the immune system. Administration of Type I IFN has been shown experimentally to inhibit tumor growth in animals, but the beneficial action in human tumors has not been widely documented. A virus-infected cell releases viral particles that can infect nearby cells. However, the infected cell can protect neighboring cells against a potential infection of the virus by releasing interferons. In response to interferon, cells produce large amounts of an enzyme known as protein kinase R (PKR). This enzyme phosphorylates a protein known as eIF-2 in response to new viral infections; the phosphorylated eIF-2 forms an inactive complex with another protein, called eIF2B, to reduce protein synthesis within the cell. Another cellular enzyme, RNAse L—also induced by interferon action—destroys RNA within the cells to further reduce protein synthesis of both viral and host genes. Inhibited protein synthesis impairs both virus replication and infected host cells. In addition, interferons induce production of hundreds of other proteins—known collectively as interferon-stimulated genes (ISGs)—that have roles in combating viruses and other actions produced by interferon. They also limit viral spread by increasing p53 activity, which kills virus-infected cells by promoting apoptosis. The effect of IFN on p53 is also linked to its protective role against certain cancers.

Another function of interferons is to up-regulate major histocompatibility complex molecules, MHC I and MHC II, and increase immunoproteasome activity. All interferons significantly enhance the presentation of MHC I dependent antigens. Interferon gamma (IFN-gamma) also significantly stimulates the MHC II-dependent presentation of antigens. Higher MHC I expression increases presentation of viral and abnormal peptides from cancer cells to cytotoxic T cells, while the immunoproteasome processes these peptides for loading onto the MHC I molecule, thereby increasing the recognition and killing of infected or malignant cells. Higher MHC II expression increases presentation of these peptides to helper T cells; these cells release cytokines (such as more interferons and interleukins, among others) that signal to and co-ordinate the activity of other immune cells.

Interferons can also suppress angiogenesis by down regulation of angiogenic stimuli deriving from tumor cells. They also suppress the proliferation of endothelial cells. Such suppression causes a decrease in tumor angiogenesis, a decrease in its vascularization and subsequent growth inhibition. Interferons, such as interferon gamma, directly activate other immune cells, such as macrophages and natural killer cells.

Induction of interferons

Production of interferons occurs mainly in response to microbes, such as viruses and bacteria, and their products. Binding of molecules uniquely found in microbes—viral glycoproteins, viral RNA, bacterial endotoxin (lipopolysaccharide), bacterial flagella, CpG motifs—by pattern recognition receptors, such as membrane bound toll like receptors or the cytoplasmic receptors RIG-I or MDA5, can trigger release of IFNs. Toll Like Receptor 3 (TLR3) is important for inducing interferons in response to the presence of double-stranded RNA viruses; the ligand for this receptor is double-stranded RNA (dsRNA). After binding dsRNA, this receptor activates the transcription factors IRF3 and NF-κB, which are important for initiating synthesis of many inflammatory proteins. RNA interference technology tools such as siRNA or vector-based reagents can either silence or stimulate interferon pathways. Release of IFN from cells (specifically IFN-γ in lymphoid cells) is also induced by mitogens. Other cytokines, such as interleukin 1, interleukin 2, interleukin-12, tumor necrosis factor and colony-stimulating factor, can also enhance interferon production.

Downstream signaling

By interacting with their specific receptors, IFNs activate signal transducer and activator of transcription (STAT) complexes; STATs are a family of transcription factors that regulate the expression of certain immune system genes. Some STATs are activated by both type I and type II IFNs. However each IFN type can also activate unique STATs.

STAT activation initiates the most well-defined cell signaling pathway for all IFNs, the classical Janus kinase-STAT (JAK-STAT) signaling pathway. In this pathway, JAKs associate with IFN receptors and, following receptor engagement with IFN, phosphorylate both STAT1 and STAT2. As a result, an IFN-stimulated gene factor 3 (ISGF3) complex forms—this contains STAT1, STAT2 and a third transcription factor called IRF9—and moves into the cell nucleus. Inside the nucleus, the ISGF3 complex binds to specific nucleotide sequences called IFN-stimulated response elements (ISREs) in the promoters of certain genes, known as IFN stimulated genes ISGs. Binding of ISGF3 and other transcriptional complexes activated by IFN signaling to these specific regulatory elements induces transcription of those genes. A collection of known ISGs is available on Interferome, a curated online database of ISGs (www.interferome.org); Additionally, STAT homodimers or heterodimers form from different combinations of STAT-1, -3, -4, -5, or -6 during IFN signaling; these dimers initiate gene transcription by binding to IFN-activated site (GAS) elements in gene promoters. Type I IFNs can induce expression of genes with either ISRE or GAS elements, but gene induction by type II IFN can occur only in the presence of a GAS element.

In addition to the JAK-STAT pathway, IFNs can activate several other signaling cascades. For instance, both type I and type II IFNs activate a member of the CRK family of adaptor proteins called CRKL, a nuclear adaptor for STAT5 that also regulates signaling through the C3G/Rap1 pathway. Type I IFNs further activate p38 mitogen-activated protein kinase (MAP kinase) to induce gene transcription. Antiviral and antiproliferative effects specific to type I IFNs result from p38 MAP kinase signaling. The phosphatidylinositol 3-kinase (PI3K) signaling pathway is also regulated by both type I and type II IFNs. PI3K activates P70-S6 Kinase 1, an enzyme that increases protein synthesis and cell proliferation; phosphorylates ribosomal protein s6, which is involved in protein synthesis; and phosphorylates a translational repressor protein called eukaryotic translation-initiation factor 4E-binding protein 1 (EIF4EBP1) in order to deactivate it.

Interferons can disrupt signaling by other stimuli. For example, interferon alpha induces RIG-G, which disrupts the CSN5-containing COP9 signalosome (CSN), a highly conserved multiprotein complex implicated in protein deneddylation, deubiquitination, and phosphorylation. RIG-G has shown the capacity to inhibit NF-κB and STAT3 signaling in lung cancer cells, which demonstrates the potential of type I IFNs.

Viral resistance to interferons

Many viruses have evolved mechanisms to resist interferon activity. They circumvent the IFN response by blocking downstream signaling events that occur after the cytokine binds to its receptor, by preventing further IFN production, and by inhibiting the functions of proteins that are induced by IFN. Viruses that inhibit IFN signaling include Japanese Encephalitis Virus (JEV), dengue type 2 virus (DEN-2), and viruses of the herpesvirus family, such as human cytomegalovirus (HCMV) and Kaposi's sarcoma-associated herpesvirus (KSHV or HHV8). Viral proteins proven to affect IFN signaling include EBV nuclear antigen 1 (EBNA1) and EBV nuclear antigen 2 (EBNA-2) from Epstein-Barr virus, the large T antigen of Polyomavirus, the E7 protein of Human papillomavirus (HPV), and the B18R protein of vaccinia virus. Reducing IFN-α activity may prevent signaling via STAT1, STAT2, or IRF9 (as with JEV infection) or through the JAK-STAT pathway (as with DEN-2 infection). Several poxviruses encode soluble IFN receptor homologs—like the B18R protein of the vaccinia virus—that bind to and prevent IFN interacting with its cellular receptor, impeding communication between this cytokine and its target cells. Some viruses can encode proteins that bind to double-stranded RNA (dsRNA) to prevent the activity of RNA-dependent protein kinases; this is the mechanism reovirus adopts using its sigma 3 (σ3) protein, and vaccinia virus employs using the gene product of its E3L gene, p25. The ability of interferon to induce protein production from interferon stimulated genes (ISGs) can also be affected. Production of protein kinase R, for example, can be disrupted in cells infected with JEV. Some viruses escape the anti-viral activities of interferons by gene (and thus protein) mutation. The H5N1 influenza virus, also known as bird flu, has resistance to interferon and other anti-viral cytokines that is attributed to a single amino acid change in its Non-Structural Protein 1 (NS1), although the precise mechanism of how this confers immunity is unclear. The relative resistance of hepatitis C virus genotype I to interferon-based therapy has been attributed in part to homology between viral envelope protein E2 and host protein kinase R, a mediator of interferon-induced suppression of viral protein translation, although mechanisms of acquired and intrinsic resistance to interferon therapy in HCV are polyfactorial.

Coronavirus response

Coronaviruses evade innate immunity during the first ten days of viral infection. In the early stages of infection, SARS-CoV-2 induces an even lower interferon type I (IFN-I) response than SARS-CoV, which itself is a weak IFN-I inducer in human cells. SARS-CoV-2 limits the IFN-III response as well. Reduced numbers of plasmacytoid dendritic cells with age is associated with increased COVID-19 severity, possibly because these cells are substantial interferon producers.

Ten percent of patients with life-threatening COVID-19 have autoantibodies against type I interferon.

Delayed IFN-I response contributes to the pathogenic inflammation (cytokine storm) seen in later stages of COVID-19 disease. Application of IFN-I prior to (or in the very early stages of) viral infection can be protective, as can treatment with pegylated IFN-λIII,[42] which should be validated in randomized clinical trials.

Interferon therapy

Three vials filled with human leukocyte interferon

Diseases

Interferon beta-1a and interferon beta-1b are used to treat and control multiple sclerosis, an autoimmune disorder. This treatment may help in reducing attacks in relapsing-remitting multiple sclerosis and slowing disease progression and activity in secondary progressive multiple sclerosis.

Interferon therapy is used (in combination with chemotherapy and radiation) as a treatment for some cancers. This treatment can be used in hematological malignancy, such as in leukemia and lymphomas including hairy cell leukemia, chronic myeloid leukemia, nodular lymphoma, and cutaneous T-cell lymphoma. Patients with recurrent melanomas receive recombinant IFN-α2b.

Both hepatitis B and hepatitis C can be treated with IFN-α, often in combination with other antiviral drugs. Some of those treated with interferon have a sustained virological response and can eliminate hepatitis virus in the case of hepatitis C. The most common strain of hepatitis C virus (HCV) worldwide—genotype I— can be treated with interferon-α, ribavirin and protease inhibitors such as telaprevir, boceprevir or the nucleotide analog polymerase inhibitor sofosbuvir. Biopsies of patients given the treatment show reductions in liver damage and cirrhosis. Control of chronic hepatitis C by IFN is associated with reduced hepatocellular carcinoma. A single nucleotide polymorphism (SNP) in the gene encoding the type III interferon IFN-λ3 was found to be protective against chronic infection following proven HCV infection and predicted treatment response to interferon-based regimens. The frequency of the SNP differed significantly by race, partly explaining observed differences in response to interferon therapy between European-Americans and African-Americans.

Unconfirmed results suggested that interferon eye drops may be an effective treatment for people who have herpes simplex virus epithelial keratitis, a type of eye infection. There is no clear evidence to suggest that removing the infected tissue (debridement) followed by interferon drops is an effective treatment approach for these types of eye infections. Unconfirmed results suggested that the combination of interferon and an antiviral agent may speed the healing process compared to antiviral therapy alone.

When used in systemic therapy, IFNs are mostly administered by an intramuscular injection. The injection of IFNs in the muscle or under the skin is generally well tolerated. The most frequent adverse effects are flu-like symptoms: increased body temperature, feeling ill, fatigue, headache, muscle pain, convulsion, dizziness, hair thinning, and depression. Erythema, pain, and hardness at the site of injection are also frequently observed. IFN therapy causes immunosuppression, in particular through neutropenia and can result in some infections manifesting in unusual ways.

Drug formulations

Pharmaceutical forms of interferons
Generic name Brand name
Interferon alfa Multiferon
Interferon alpha 2a Roferon A
Interferon alpha 2b Intron A/Reliferon/Uniferon
Human leukocyte Interferon-alpha (HuIFN-alpha-Le) Multiferon
Interferon beta 1a, liquid form Rebif
Interferon beta 1a, lyophilized Avonex
Interferon beta 1a, biogeneric (Iran) Cinnovex
Interferon beta 1b Betaseron / Betaferon
Interferon gamma 1b Actimmune
PEGylated interferon alpha 2a Pegasys
PEGylated interferon alpha 2a (Egypt) Reiferon Retard
PEGylated interferon alpha 2b PegIntron
Ropeginterferon alfa-2b Besremi
PEGylated interferon alpha 2b plus ribavirin (Canada) Pegetron

Several different types of interferons are approved for use in humans. One was first approved for medical use in 1986. For example, in January 2001, the Food and Drug Administration (FDA) approved the use of PEGylated interferon-alpha in the USA; in this formulation, PEGylated interferon-alpha-2b (Pegintron), polyethylene glycol is linked to the interferon molecule to make the interferon last longer in the body. Approval for PEGylated interferon-alpha-2a (Pegasys) followed in October 2002. These PEGylated drugs are injected once weekly, rather than administering two or three times per week, as is necessary for conventional interferon-alpha. When used with the antiviral drug ribavirin, PEGylated interferon is effective in treatment of hepatitis C; at least 75% of people with hepatitis C genotypes 2 or 3 benefit from interferon treatment, although this is effective in less than 50% of people infected with genotype 1 (the more common form of hepatitis C virus in both the U.S. and Western Europe). Interferon-containing regimens may also include protease inhibitors such as boceprevir and telaprevir.

There are also interferon-inducing drugs, notably tilorone that is shown to be effective against Ebola virus.

History

Sidney Pestka of Rutgers University, seen here receiving the National Medal of Technology.

Interferons were first described in 1957 by Alick Isaacs and Jean Lindenmann at the National Institute for Medical Research in London; the discovery was a result of their studies of viral interference. Viral interference refers to the inhibition of virus growth caused by previous exposure of cells to an active or a heat-inactivated virus. Isaacs and Lindenmann were working with a system that involved the inhibition of the growth of live influenza virus in chicken embryo chorioallantoic membranes by heat-inactivated influenza virus. Their experiments revealed that this interference was mediated by a protein released by cells in the heat-inactivated influenza virus-treated membranes. They published their results in 1957 naming the antiviral factor they had discovered interferon. The findings of Isaacs and Lindenmann have been widely confirmed and corroborated in the literature.

Furthermore, others may have made observations on interferons before the 1957 publication of Isaacs and Lindenmann. For example, during research to produce a more efficient vaccine for smallpox, Yasu-ichi Nagano and Yasuhiko Kojima—two Japanese virologists working at the Institute for Infectious Diseases at the University of Tokyo—noticed inhibition of viral growth in an area of rabbit-skin or testis previously inoculated with UV-inactivated virus. They hypothesised that some "viral inhibitory factor" was present in the tissues infected with virus and attempted to isolate and characterize this factor from tissue homogenates. Independently, Monto Ho, in John Enders's lab, observed in 1957 that attenuated poliovirus conferred a species specific anti-viral effect in human amniotic cell cultures. They described these observations in a 1959 publication, naming the responsible factor viral inhibitory factor (VIF). It took another fifteen to twenty years, using somatic cell genetics, to show that the interferon action gene and interferon gene reside in different human chromosomes. The purification of human beta interferon did not occur until 1977. Y.H. Tan and his co-workers purified and produced biologically active, radio-labeled human beta interferon by superinducing the interferon gene in fibroblast cells, and they showed its active site contains tyrosine residues. Tan's laboratory isolated sufficient amounts of human beta interferon to perform the first amino acid, sugar composition and N-terminal analyses. They showed that human beta interferon was an unusually hydrophobic glycoprotein. This explained the large loss of interferon activity when preparations were transferred from test tube to test tube or from vessel to vessel during purification. The analyses showed the reality of interferon activity by chemical verification. The purification of human alpha interferon was not reported until 1978. A series of publications from the laboratories of Sidney Pestka and Alan Waldman between 1978 and 1981, describe the purification of the type I interferons IFN-α and IFN-β. By the early 1980s, genes for these interferons had been cloned, adding further definitive proof that interferons were responsible for interfering with viral replication.[81] Gene cloning also confirmed that IFN-α was encoded by a family of many related genes.[82] The type II IFN (IFN-γ) gene was also isolated around this time.[83]

Interferon was first synthesized manually at Rockefeller University in the lab of Dr. Bruce Merrifield, using solid phase peptide synthesis, one amino acid at a time. He later won the Nobel Prize in chemistry. Interferon was scarce and expensive until 1980, when the interferon gene was inserted into bacteria using recombinant DNA technology, allowing mass cultivation and purification from bacterial cultures or derived from yeasts. Interferon can also be produced by recombinant mammalian cells. Before the early 1970s, large scale production of human interferon had been pioneered by Kari Cantell. He produced large amounts of human alpha interferon from large quantities of human white blood cells collected by the Finnish Blood Bank. Large amounts of human beta interferon were made by superinducing the beta interferon gene in human fibroblast cells.

Cantell's and Tan's methods of making large amounts of natural interferon were critical for chemical characterisation, clinical trials and the preparation of small amounts of interferon messenger RNA to clone the human alpha and beta interferon genes. The superinduced human beta interferon messenger RNA was prepared by Tan's lab for Cetus. to clone the human beta interferon gene in bacteria and the recombinant interferon was developed as 'betaseron' and approved for the treatment of MS. Superinduction of the human beta interferon gene was also used by Israeli scientists to manufacture human beta interferon.

Telomere

From Wikipedia, the free encyclopedia
https://en.wikipedia.org/wiki/Telomere
Human chromosomes (grey) capped by telomeres (white)

A telomere (/ˈtɛləmɪər, ˈtlə-/; from Ancient Greek τέλος (télos) 'end', and μέρος (méros) 'part') is a region of repetitive nucleotide sequences associated with specialized proteins at the ends of linear chromosomes (see Sequences). Telomeres are a widespread genetic feature most commonly found in eukaryotes. In most, if not all species possessing them, they protect the terminal regions of chromosomal DNA from progressive degradation and ensure the integrity of linear chromosomes by preventing DNA repair systems from mistaking the very ends of the DNA strand for a double-strand break.

Discovery

The existence of a special structure at the ends of chromosomes was independently proposed in 1938 by Hermann Joseph Muller, studying the fruit fly Drosophila melanogaster, and in 1939 by Barbara McClintock, working with maize. Muller observed that the ends of irradiated fruit fly chromosomes did not present alterations such as deletions or inversions. He hypothesized the presence of a protective cap, which he coined "telomeres", from the Greek telos (end) and meros (part).

In the early 1970s, Soviet theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends; this is known as the "end replication problem". Building on this, and accommodating Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends. According to his theory of marginotomy DNA sequences at the ends of telomeres are represented by tandem repeats, which create a buffer that determines the number of divisions that a certain cell clone can undergo. Furthermore, it was predicted that a specialized DNA polymerase (originally called a tandem-DNA-polymerase) could extend telomeres in immortal tissues such as germ line, cancer cells and stem cells. It also followed from this hypothesis that organisms with circular genome, such as bacteria, do not have the end replication problem and therefore do not age.

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph G. Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.

Structure and function

End replication problem

Lagging strand during DNA replication

During DNA replication, DNA polymerase cannot replicate the sequences present at the 3' ends of the parent strands. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a primer to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of RNA) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see lagging strand replication). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes) would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated. It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70–100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50–100 base pairs per cell division.

If coding sequences are degraded in this process, potentially vital genetic code would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively degraded in the process of DNA replication.

The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most prokaryotes, relying on circular chromosomes, accordingly do not possess telomeres. A small fraction of bacterial chromosomes (such as those in Streptomyces, Agrobacterium, and Borrelia), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.

Telomere ends and shelterin

Shelterin co-ordinates the T-loop formation of telomeres.

At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1. In many species, the sequence repeats are enriched in guanine, e.g. TTAGGG in vertebrates, which allows the formation of G-quadruplexes, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in ciliates (that possess telomere repeats similar to those found in vertebrates) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes such as DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription.

Telomerase

Synthesis of chromosome ends by telomerase

Many organisms have a ribonucleoprotein enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap" and requires no ATP In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be reactivated and telomeres reset back to an embryonic state by somatic cell nuclear transfer. The steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Length

Telomere length varies greatly between species, from approximately 300 base pairs in yeast to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang ranging from 75 to 300 bases, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.

Shortening

Oxidative damage

Apart from the end replication problem, in vitro studies have shown that telomeres accumulate damage due to oxidative stress and that oxidative stress-mediated DNA damage has a major influence on telomere shortening in vivo. There is a multitude of ways in which oxidative stress, mediated by reactive oxygen species (ROS), can lead to DNA damage; however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions. Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out; for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for. Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. These results suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

Association with aging

Although telomeres shorten during the lifetime of an individual, it is telomere shortening-rate rather than telomere length that is associated with the lifespan of a species. Critically short telomeres trigger a DNA damage response and cellular senescence. Mice have much longer telomeres, but a greatly accelerated telomere shortening-rate and greatly reduced lifespan compared to humans and elephants.

Telomere shortening is associated with aging, mortality, and aging-related diseases in experimental animals. Although many factors can affect human lifespan, such as smoking, diet, and exercise, as persons approach the upper limit of human life expectancy, longer telomeres may be associated with lifespan.

Potential effect of psychological stress

Meta-analyses found that increased perceived psychological stress was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for publication bias. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life.

Lengthening

The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The Hayflick limit is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.

Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.

A study reported that telomere length of different mammalian species correlates inversely rather than directly with lifespan, and concluded that the contribution of telomere length to lifespan remains controversial. There is little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities.

Sequences

Experimentally verified and predicted telomere sequence motifs from more than 9000 species are collected in research community curated database TeloBase. Some of the experimentally verified telomere nucleotide sequences are also listed in Telomerase Database website (see nucleic acid notation for letter representations).

Some known telomere nucleotide sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG
Allium CTCGGTTATGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Bombus terrestris TTAGGTTGGGG
Vespula vulgaris TTGCGTCTGGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Research on disease risk

Preliminary research indicates that disease risk in aging may be associated with telomere shortening, senescent cells, or SASP (senescence-associated secretory phenotype).

Measurement

Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot. There is a Web-based Analyser of the Length of Telomeres (WALTER), software processing the TRF pictures. A Real-Time PCR assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.

Tools have also been developed to estimate the length of telomere from whole genome sequencing (WGS) experiments. Amongst these are TelSeq, Telomerecat and telomereHunter. Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. Flow-FISH is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006.

While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company, promoted the clinical utility of telomere length measures.

In wildlife

During the last two decades, eco-evolutionary studies have investigated the relevance of life-history traits and environmental conditions on telomeres of wildlife. Most of these studies have been conducted in endotherms, i.e. birds and mammals. They have provided evidence for the inheritance of telomere length; however, heritability estimates vary greatly within and among species. Age and telomere length often negatively correlate in vertebrates, but this decline is variable among taxa and linked to the method used for estimating telomere length. In contrast, the available information shows no sex differences in telomere length across vertebrates. Phylogeny and life history traits such as body size or the pace of life can also affect telomere dynamics. For example, it has been described across species of birds and mammals. In 2019, a meta-analysis confirmed that the exposure to stressors (e.g. pathogen infection, competition, reproductive effort and high activity level) was associated with shorter telomeres across different animal taxa.

Studies on ectotherms, and other non-mammalian organisms, show that there is no single universal model of telomere erosion; rather, there is wide variation in relevant dynamics across Metazoa, and even within smaller taxonomic groups these patterns appear diverse.

RNA world

From Wikipedia, the free encyclopedia
A comparison of RNA (left) with DNA (right), showing the helices and nucleobases each employs

The RNA world is a hypothetical stage in the evolutionary history of life on Earth, in which self-replicating RNA molecules proliferated before the evolution of DNA and proteins. The term also refers to the hypothesis that posits the existence of this stage.

Alexander Rich first proposed the concept of the RNA world in 1962, and Walter Gilbert coined the term in 1986. Alternative chemical paths to life have been proposed, and RNA-based life may not have been the first life to exist. Even so, the RNA world hypothesis seems to be the most favored abiogenesis paradigm, but even proponents agree it still has not reached conclusive evidence to completely falsify other paradigms and hypotheses. The concurrent formation of all four RNA building blocks further strengthened the hypothesis. Regardless of its plausibility in a prebiotic scenario, the RNA world can serve as a model system for studying the origin of life.

  • Like DNA, RNA can store and replicate genetic information.
  • Like protein enzymes, RNA enzymes (ribozymes) can catalyze (start or accelerate) chemical reactions that are critical for life.

One of the most critical components of cells, the ribosome, is composed primarily of RNA. Ribonucleotide moieties in many coenzymes, such as acetyl-CoA, NADH, FADH, and F420, may be surviving remnants of covalently bound coenzymes in an RNA world.

Although RNA is fragile, some ancient RNAs may have evolved the ability to methylate other RNAs to protect them.

If the RNA world existed, it was probably followed by an age characterized by the evolution of ribonucleoproteins (RNP world), which in turn ushered in the era of DNA and longer proteins. DNA has greater stability and durability than RNA; this may explain why it became the predominant information storage molecule. Protein enzymes may have come to replace RNA-based ribozymes as biocatalysts because their greater abundance and diversity of monomers makes them more versatile. As some cofactors contain both nucleotide and amino-acid characteristics, it may be that amino acids, peptides and finally proteins initially were cofactors for ribozymes.

History

One of the challenges in studying abiogenesis is that the system of reproduction and metabolism utilized by all extant life involves three distinct types of interdependent macromolecules (DNA, RNA, and proteins). This suggests that life could not have arisen in its current form, which has led researchers to hypothesize mechanisms whereby the current system might have arisen from a simpler precursor system. American molecular biologist Alexander Rich was the first to posit a coherent hypothesis on the origin of nucleotides as precursors of life. In an article he contributed to a volume issued in honor of Nobel-laureate physiologist Albert Szent-Györgyi, he explained that the primitive Earth's environment could have produced RNA molecules (polynucleotide monomers) that eventually acquired enzymatic and self-replicating functions.

Further concept of RNA as a primordial molecule can be found in papers by Francis Crick and Leslie Orgel, as well as in Carl Woese's 1967 book The Genetic Code. Hans Kuhn in 1972 laid out a possible process by which the modern genetic system might have arisen from a nucleotide-based precursor, and this led Harold White in 1976 to observe that many of the cofactors essential for enzymatic function are either nucleotides or could have been derived from nucleotides. He proposed a scenario whereby the critical electrochemistry of enzymatic reactions would have necessitated retention of the specific nucleotide moieties of the original RNA-based enzymes carrying out the reactions, while the remaining structural elements of the enzymes were gradually replaced by protein, until all that remained of the original RNAs were these nucleotide cofactors, "fossils of nucleic acid enzymes". The phrase "RNA World" was first used by Nobel laureate Walter Gilbert in 1986, in a commentary on how recent observations of the catalytic properties of various forms of RNA fit with this hypothesis.

Properties of RNA

The properties of RNA make the idea of the RNA world hypothesis conceptually plausible, though its general acceptance as an explanation for the origin of life requires further evidence. RNA is known to form efficient catalysts and its similarity to DNA makes clear its ability to store information. Opinions differ, however, as to whether RNA constituted the first autonomous self-replicating system or was a derivative of a still-earlier system. One version of the hypothesis is that a different type of nucleic acid, termed pre-RNA, was the first one to emerge as a self-reproducing molecule, to be replaced by RNA only later. On the other hand, the discovery in 2009 that activated pyrimidine ribonucleotides can be synthesized under plausible prebiotic conditions suggests that it is premature to dismiss the RNA-first scenarios. Suggestions for 'simple' pre-RNA nucleic acids have included peptide nucleic acid (PNA), threose nucleic acid (TNA) or glycol nucleic acid (GNA). Despite their structural simplicity and possession of properties comparable with RNA, the chemically plausible generation of "simpler" nucleic acids under prebiotic conditions has yet to be demonstrated.

RNA as an enzyme

In the 1980s, RNA structures capable of self-processing were discovered, with the RNA moiety of RNase P acting as its catalytic subunit. These catalytic RNAs were referred to as RNA enzymes, or ribozymes, are found in today's DNA-based life and could be examples of living fossils. Ribozymes play vital roles, such as that of the ribosome. The large subunit of the ribosome includes an rRNA responsible for the peptide bond-forming peptidyl transferase activity of protein synthesis. Many other ribozyme activities exist; for example, the hammerhead ribozyme performs self-cleavage and an RNA polymerase ribozyme can synthesize a short RNA strand from a primed RNA template.

Among the enzymatic properties important for the beginning of life are:

Self-replication
The ability to self-replicate or synthesize other RNA molecules; relatively short RNA molecules that can synthesize others have been artificially produced in the lab. The shortest was 165 bases long, though it has been estimated that only part of the molecule was crucial for this function. One version, 189 bases long, had an error rate of just 1.1% per nucleotide when synthesizing an 11-nucleotide long RNA strand from primed template strands. This 189-base pair ribozyme could polymerize a template of at most 14 nucleotides in length, which is too short for self-replication, but is a potential lead for further investigation. The longest primer extension performed by a ribozyme polymerase was 20 bases. In 2016, researchers reported the use of in vitro evolution to improve dramatically the activity and generality of an RNA polymerase ribozyme by selecting variants that can synthesize functional RNA molecules from an RNA template. Each RNA polymerase ribozyme was engineered to remain linked to its new, synthesized RNA strand; this allowed the team to isolate successful polymerases. The isolated RNA polymerases were again used for another round of evolution. After several rounds of evolution, they obtained one RNA polymerase ribozyme called 24-3 that was able to copy almost any other RNA, from small catalysts to long RNA-based enzymes. Particular RNAs were amplified up to 10,000 times, a first RNA version of the polymerase chain reaction (PCR).
Catalysis
The ability to catalyze simple chemical reactions—which would enhance creation of molecules that are building blocks of RNA molecules (i.e., a strand of RNA that would make creating more strands of RNA easier). Relatively short RNA molecules with such abilities have been artificially formed in the lab. A recent study showed that almost any nucleic acid can evolve into a catalytic sequence under appropriate selection. For instance, an arbitrarily chosen 50-nucleotide DNA fragment encoding for the Bos taurus (cattle) albumin mRNA was subjected to test-tube evolution to derive a catalytic DNA (Deoxyribozyme, also called DNAzyme) with RNA-cleavage activity. After only a few weeks, a DNAzyme with significant catalytic activity had evolved. In general, DNA is much more chemically inert than RNA and hence much more resistant to obtaining catalytic properties. If in vitro evolution works for DNA it will happen much more easily with RNA. In 2022, Nick Lane and coauthors showed in a computational simulation that short RNA sequences could have been capable of catalyzing CO2 fixation which supported protocell replication and growth.
Amino acid-RNA ligation
The ability to conjugate an amino acid to the 3'-end of an RNA in order to use its chemical groups or provide a long-branched aliphatic sidechain.
Peptide bond formation
The ability to catalyse the formation of peptide bonds between amino acids to produce short peptides or longer proteins. This is done in modern cells by ribosomes, a complex of several RNA molecules known as rRNA together with many proteins. The rRNA molecules are thought responsible for its enzymatic activity, as no amino-acid residues lie within 18Å of the enzyme's active site, and, when the majority of the amino-acid residues in the ribosome were stringently removed, the resulting ribosome retained its full peptidyl transferase activity, fully able to catalyze the formation of peptide bonds between amino acids. A pseudo 2 fold symmetry of the region surrounding the peptidyl transferase center led to the hypothesis of the Proto-Ribosome, that a vestige of an ancient dimeric molecule from the RNA world is functioning within the ribosome. An RNA molecule with the ribosomal RNA sequence has been synthesized in the lab to test the Proto-ribosome hypothesis and was able to dimerize and to form peptide bonds. A much shorter RNA molecule has been synthesized in the laboratory with the ability to form peptide bonds, and it has been suggested that rRNA has evolved from a similar molecule. It has also been suggested that amino acids may have initially been involved with RNA molecules as cofactors enhancing or diversifying their enzymatic capabilities, before evolving into more complex peptides. Similarly, tRNA is suggested to have evolved from RNA molecules that began to catalyze amino acid transfer.

Cofactors

Protein enzymes catalyze various chemical reactions, but over half of them incorporate cofactors to facilitate and diversify their catalytic activities. Cofactors are essential in biology, as they are based largely on nucleotides rather than amino acids. Ribozymes use nucleotide cofactors to create metabolism, with two basic choices: non-covalent binding or covalent attachment. Both approaches have been demonstrated using directed evolution to reinvent RNA dupes of protein-catalyzed processes. Lorsch and Szostak  investigated ribozymes that could phosphorylate themselves and use ATP-γS as a substrate. However, only one of the seven classes of selected ribozymes had detectable ATP affinity, indicating that the ability to bind ATP was compromised. NAD+- dependent redox ribozymes were also evaluated. The select ribozyme had a rate of enhancement of more than 107 fold and was proven to catalyze the reverse reaction - benzaldehyde reduction by NADH. Since the usage of adenosine as a cofactor is prevalent in current metabolism and is likely to have been common in the RNA world, these discoveries are essential for the evolution of metabolism in the RNA world.

RNA in information storage

RNA is a very similar molecule to DNA, with only two significant chemical differences (the backbone of RNA uses ribose instead of deoxyribose and its nucleobases include uracil instead of thymine). The overall structure of RNA and DNA are immensely similar—one strand of DNA and one of RNA can bind to form a double helical structure. This makes the storage of information in RNA possible in a very similar way to the storage of information in DNA. However, RNA is less stable, being more prone to hydrolysis due to the presence of a hydroxyl group at the ribose 2' position.

The major difference between RNA and DNA is the presence of a hydroxyl group at the 2'-position.

Comparison of DNA and RNA structure

The major difference between RNA and DNA is the presence of a hydroxyl group at the 2'-position of the ribose sugar in RNA (illustration, right). This group makes the molecule less stable because, when not constrained in a double helix, the 2' hydroxyl can chemically attack the adjacent phosphodiester bond to cleave the phosphodiester backbone. The hydroxyl group also forces the ribose into the C3'-endo sugar conformation unlike the C2'-endo conformation of the deoxyribose sugar in DNA. This forces an RNA double helix to change from a B-DNA structure to one more closely resembling A-DNA.

RNA also uses a different set of bases than DNA—adenine, guanine, cytosine and uracil, instead of adenine, guanine, cytosine and thymine. Chemically, uracil is similar to thymine, differing only by a methyl group, and its production requires less energy. In terms of base pairing, this has no effect. Adenine readily binds uracil or thymine. Uracil is, however, one product of damage to cytosine that makes RNA particularly susceptible to mutations that can replace a GC base pair with a GU (wobble) or AU base pair.

RNA is thought to have preceded DNA, because of their ordering in the biosynthetic pathways. The deoxyribonucleotides used to make DNA are made from ribonucleotides, the building blocks of RNA, by removing the 2'-hydroxyl group. As a consequence, a cell must have the ability to make RNA before it can make DNA.

Limitations of information storage in RNA

The chemical properties of RNA make large RNA molecules inherently fragile, and they can easily be broken down into their constituent nucleotides through hydrolysis. These limitations do not make use of RNA as an information storage system impossible, simply energy intensive (to repair or replace damaged RNA molecules) and prone to mutation. While this makes it unsuitable for current 'DNA optimised' life, it may have been acceptable for more primitive life.

RNA as a regulator

Riboswitches have been found to act as regulators of gene expression, particularly in bacteria, but also in plants and archaea. Riboswitches alter their secondary structure in response to the binding of a metabolite. Riboswitch classes have highly conserved aptamer domains, even among diverse organisms. When a target metabolite is bound to this aptamer, conformational changes occur, modulating the expression of genes carried by mRNA. These changes occur in an expression platform, located downstream from the aptamer. This change in structure can result in the formation or disruption of a terminator, truncating or permitting transcription respectively. Alternatively, riboswitches may bind or occlude the Shine–Dalgarno sequence, affecting translation. It has been suggested that these originated in an RNA-based world. In addition, RNA thermometers regulate gene expression in response to temperature changes.

Support and difficulties

The RNA world hypothesis is supported by RNA's ability to do all three of to store, to transmit, and to duplicate genetic information, as DNA does, and to perform enzymatic reactions, like protein-based enzymes. Because it can carry out the types of tasks now performed by proteins and DNA, RNA is believed to have once been capable of supporting independent life on its own. Some viruses use RNA as their genetic material, rather than DNA. Further, while nucleotides were not found in experiments based on Miller-Urey experiment, their formation in prebiotically plausible conditions was reported in 2009; a purine base, adenine, is merely a pentamer of hydrogen cyanide, and it happens that this particular base is used as omnipresent energy vehicle in the cell: adenosine triphosphate is used everywhere in preference to guanosine triphosphate, cytidine triphosphate, uridine triphosphate or even deoxythymidine triphosphate, which could serve just as well but are practically never used except as building blocks for nucleic acid chains. Experiments with basic ribozymes, like Bacteriophage Qβ RNA, have shown that simple self-replicating RNA structures can withstand even strong selective pressures (e.g., opposite-chirality chain terminators).

Since there were no known chemical pathways for the abiogenic synthesis of nucleotides from pyrimidine nucleobases cytosine and uracil under prebiotic conditions, it is thought by some that nucleic acids did not contain these nucleobases seen in life's nucleic acids. The nucleoside cytosine has a half-life in isolation of 19 days at 100 °C (212 °F) and 17,000 years in freezing water, which some argue is too short on the geologic time scale for accumulation. Others have questioned whether ribose and other backbone sugars could be stable enough to be found in the original genetic material, and have raised the issue that all ribose molecules would have had to be the same enantiomer, as any nucleotide of the wrong chirality acts as a chain terminator.

Pyrimidine ribonucleosides and their respective nucleotides have been prebiotically synthesised by a sequence of reactions that by-pass free sugars and assemble in a stepwise fashion by including nitrogenous and oxygenous chemistries. In a series of publications, John Sutherland and his team at the School of Chemistry, University of Manchester, have demonstrated high yielding routes to cytidine and uridine ribonucleotides built from small 2- and 3-carbon fragments such as glycolaldehyde, glyceraldehyde or glyceraldehyde-3-phosphate, cyanamide, and cyanoacetylene. One of the steps in this sequence allows the isolation of enantiopure ribose aminooxazoline if the enantiomeric excess of glyceraldehyde is 60% or greater, of possible interest toward biological homochirality. This can be viewed as a prebiotic purification step, where the said compound spontaneously crystallised out from a mixture of the other pentose aminooxazolines. Aminooxazolines can react with cyanoacetylene in a mild and highly efficient manner, controlled by inorganic phosphate, to give the cytidine ribonucleotides. Photoanomerization with UV light allows for inversion about the 1' anomeric centre to give the correct beta stereochemistry; one problem with this chemistry is the selective phosphorylation of alpha-cytidine at the 2' position. However, in 2009, they showed that the same simple building blocks allow access, via phosphate controlled nucleobase elaboration, to 2',3'-cyclic pyrimidine nucleotides directly, which are known to be able to polymerise into RNA. Organic chemist Donna Blackmond described this finding as "strong evidence" in favour of the RNA world. However, John Sutherland said that while his team's work suggests that nucleic acids played an early and central role in the origin of life, it did not necessarily support the RNA world hypothesis in the strict sense, which he described as a "restrictive, hypothetical arrangement".

The Sutherland group's 2009 paper also highlighted the possibility for the photo-sanitization of the pyrimidine-2',3'-cyclic phosphates. A potential weakness of these routes is the generation of enantioenriched glyceraldehyde, or its 3-phosphate derivative (glyceraldehyde prefers to exist as its keto tautomer dihydroxyacetone).

On August 8, 2011, a report, based on NASA studies with meteorites found on Earth, was published suggesting building blocks of RNA (adenine, guanine, and related organic molecules) may have been formed in outer space. In 2017, research using a numerical model suggested that a RNA world may have emerged in warm ponds on the early Earth, and that meteorites were a plausible and probable source of the RNA building blocks (ribose and nucleic acids) to these environments. On August 29, 2012, astronomers at Copenhagen University reported the detection of a specific sugar molecule, glycolaldehyde, in a distant star system. The molecule was found around the protostellar binary IRAS 16293-2422, which is located 400 light years from Earth. Because glycolaldehyde is needed to form RNA, this finding suggests that complex organic molecules may form in stellar systems prior to the formation of planets, eventually arriving on young planets early in their formation. Nitriles, key molecular precursors of the RNA World scenario, are among the most abundant chemical families in the universe and have been found in molecular clouds in the center of the Milky Way, protostars of different masses, meteorites and comets, and also in the atmosphere of Titan, the largest moon of Saturn.

A study in 2001 shows that nicotinic acid and its precursor, quinolinic acid can be "produced in yields as high as 7% in a six-step nonenzymatic sequence from aspartic acid and dihydroxyacetone phosphate (DHAP). The biosynthesis of ribose phosphate could have produced DHAP and other three carbon compounds. Aspartic acid could have been available from prebiotic synthesis or from the ribozyme synthesis of pyrimidines." This supports that NAD could have originated in the RNA world. RNA sequences at lengths of 30 nucleotides, 60 nucleotides, 100 nucleotides, and 140 nucleotides, were capable of catalysis of "the synthesis of three common coenzymes, CoA, NAD, and FAD, from their precursors, 4‘-phosphopantetheine, NMN, and FMN, respectively".

Prebiotic RNA synthesis

The RNA world hypothesis proposes that spontaneous polymerization of ribonucleotides led to the emergence of ribozymes and including an RNA replicase.

Nucleotides are the fundamental molecules that combine in series to form RNA. They consist of a nitrogenous base attached to a sugar-phosphate backbone. RNA is made of long stretches of specific nucleotides arranged so that their sequence of bases carries information. The RNA world hypothesis holds that in the primordial soup (or sandwich), there existed free-floating nucleotides. These nucleotides regularly formed bonds with one another, which often broke because the change in energy was so low. However, certain sequences of base pairs have catalytic properties that lower the energy of their chain being created, enabling them to stay together for longer periods of time. As each chain grew longer, it attracted more matching nucleotides faster, causing chains to now form faster than they were breaking down.

These chains have been proposed by some as the first, primitive forms of life. In an RNA world, different sets of RNA strands would have had different replication outputs, which would have increased or decreased their frequency in the population, i.e., natural selection. As the fittest sets of RNA molecules expanded their numbers, novel catalytic properties added by mutation, which benefitted their persistence and expansion, could accumulate in the population. Such an autocatalytic set of ribozymes, capable of self-replication in about an hour, has been identified. It was produced by molecular competition (in vitro evolution) of candidate enzyme mixtures.

Competition between RNA may have favored the emergence of cooperation between different RNA chains, opening the way for the formation of the first protocell. Eventually, RNA chains developed with catalytic properties that help amino acids bind together (a process called peptide-bonding). These amino acids could then assist with RNA synthesis, giving those RNA chains that could serve as ribozymes the selective advantage. The ability to catalyze one step in protein synthesis, aminoacylation of RNA, has been demonstrated in a short (five-nucleotide) segment of RNA.

In March 2015, NASA scientists reported that, for the first time, complex DNA and RNA organic compounds of life, including uracil, cytosine, and thymine, have been formed in the laboratory under conditions found only in outer space, using starting chemicals, like pyrimidine, found in meteorites. Pyrimidine, like polycyclic aromatic hydrocarbons (PAHs), may have been formed in red giant stars or in interstellar dust and gas clouds, according to the scientists.

In 2018, researchers at Georgia Institute of Technology identified three molecular candidates for the bases that might have formed an earliest version of proto-RNA: barbituric acid, melamine, and 2,4,6-triaminopyrimidine (TAP). These three molecules are simpler versions of the four bases in current RNA, which could have been present in larger amounts and could still be forward-compatible with them but may have been discarded by evolution in exchange for more optimal base pairs. Specifically, TAP can form nucleotides with a large range of sugars. Both TAP and melamine base pair with barbituric acid. All three spontaneously form nucleotides with ribose.

Evolution of DNA

One of the challenges posed by the RNA world hypothesis is to discover the pathway by which an RNA-based system transitioned to one based on DNA. Geoffrey Diemer and Ken Stedman, at Portland State University in Oregon, may have found a solution. While conducting a survey of viruses in a hot acidic lake in Lassen Volcanic National Park, California, they uncovered evidence that a simple DNA virus had acquired a gene from a completely unrelated RNA-based virus. Virologist Luis Villareal of the University of California Irvine also suggests that viruses capable of converting an RNA-based gene into DNA and then incorporating it into a more complex DNA-based genome might have been common in the Virus world during the RNA to DNA transition some 4 billion years ago. This finding bolsters the argument for the transfer of information from the RNA world to the emerging DNA world before the emergence of the last universal common ancestor. From the research, the diversity of this virus world is still with us.

Viroids

Additional evidence supporting the concept of an RNA world has resulted from research on viroids, the first representatives of a novel domain of "subviral pathogens". Viroids infect plants, where most are pathogens, and consist of short stretches of highly complementary, circular, single-stranded and non-coding RNA without a protein coat. They are extremely small, ranging from 246 to 467 nucleobases, compared to the smallest known viruses capable of causing an infection, with genomes about 2,000 nucleobases in length.

Based on their characteristic properties, in 1989 plant biologist Theodor Diener argued that viroids are more plausible living relics of the RNA world than introns and other RNAs considered candidates at the time. Diener's hypothesis would be expanded by the research group of Ricardo Flores, and gained a broader audience when in 2014, a New York Times science writer published a popularized version of the proposal.

The characteristics of viroids highlighted as consistent with an RNA world were their small size, high guanine and cytosine content, circular structure, structural periodicity, the lack of protein-coding ability and, in some cases, ribozyme-mediated replication. One aspect critics of the hypothesis have focused on is that the exclusive hosts of all known viroids, angiosperms, did not evolve until billions of years after the RNA world was replaced, making viroids more likely to have arisen through later evolutionary mechanisms unrelated to the RNA world than to have survived via a cryptic host over that extended period. Whether they are relics of that world or of more recent origin, their function as autonomous naked RNA is seen as analogous to that envisioned for an RNA world.

Origin of sexual reproduction

Eigen et al. and Woese proposed that the genomes of early protocells were composed of single-stranded RNA, and that individual genes corresponded to separate RNA segments, rather than being linked end-to-end as in present-day DNA genomes. A protocell that was haploid (one copy of each RNA gene) would be vulnerable to damage, since a single lesion in any RNA segment would be potentially lethal to the protocell (e.g., by blocking replication or inhibiting the function of an essential gene).

Vulnerability to damage could be reduced by maintaining two or more copies of each RNA segment in each protocell, i.e., by maintaining diploidy or polyploidy. Genome redundancy would allow a damaged RNA segment to be replaced by an additional replication of its homolog. However, for such a simple organism, the proportion of available resources tied up in the genetic material would be a large fraction of the total resource budget. Under limited resource conditions, the protocell reproductive rate would likely be inversely related to ploidy number. The protocell's fitness would be reduced by the costs of redundancy. Consequently, coping with damaged RNA genes while minimizing the costs of redundancy would likely have been a fundamental problem for early protocells.

A cost-benefit analysis was carried out in which the costs of maintaining redundancy were balanced against the costs of genome damage. This analysis led to the conclusion that, under a wide range of circumstances, the selected strategy would be for each protocell to be haploid, but to periodically fuse with another haploid protocell to form a transient diploid. The retention of the haploid state maximizes the growth rate. The periodic fusions permit mutual reactivation of otherwise lethally damaged protocells. If at least one damage-free copy of each RNA gene is present in the transient diploid, viable progeny can be formed. For two, rather than one, viable daughter cells to be produced would require an extra replication of the intact RNA gene homologous to any RNA gene that had been damaged prior to the division of the fused protocell. The cycle of haploid reproduction, with occasional fusion to a transient diploid state, followed by splitting to the haploid state, can be considered to be the sexual cycle in its most primitive form. In the absence of this sexual cycle, haploid protocells with damage in an essential RNA gene would simply die.

This model for the early sexual cycle is hypothetical, but it is very similar to the known sexual behavior of the segmented RNA viruses, which are among the simplest organisms known. Influenza virus, whose genome consists of 8 physically separated single-stranded RNA segments, is an example of this type of virus. In segmented RNA viruses, "mating" can occur when a host cell is infected by at least two virus particles. If these viruses each contain an RNA segment with a lethal damage, multiple infection can lead to reactivation providing that at least one undamaged copy of each virus gene is present in the infected cell. This phenomenon is known as "multiplicity reactivation". Multiplicity reactivation has been reported to occur in influenza virus infections after induction of RNA damage by UV-irradiation, and ionizing radiation.

Further developments

Patrick Forterre has been working on a novel hypothesis, called "three viruses, three domains": that viruses were instrumental in the transition from RNA to DNA and the evolution of Bacteria, Archaea, and Eukaryota. He believes the last universal common ancestor was RNA-based and evolved RNA viruses. Some of the viruses evolved into DNA viruses to protect their genes from attack. Through the process of viral infection into hosts the three domains of life evolved.

Another interesting proposal is the idea that RNA synthesis might have been driven by temperature gradients, in the process of thermosynthesis. Single nucleotides have been shown to catalyze organic reactions.

Steven Benner has argued that chemical conditions on the planet Mars, such as the presence of boron, molybdenum, and oxygen, may have been better for initially producing RNA molecules than those on Earth. If so, life-suitable molecules, originating on Mars, may have later migrated to Earth via mechanisms of panspermia or similar process.

Alternative hypotheses

The hypothesized existence of an RNA world does not exclude a "Pre-RNA world", where a metabolic system based on a different nucleic acid is proposed to pre-date RNA. A candidate nucleic acid is peptide nucleic acid (PNA), which uses simple peptide bonds to link nucleobases. PNA is more stable than RNA, but its ability to be generated under prebiological conditions has yet to be demonstrated experimentally.

Threose nucleic acid (TNA) has also been proposed as a starting point, as has glycol nucleic acid (GNA), and like PNA, also lack experimental evidence for their respective abiogenesis.

An alternative—or complementary—theory of RNA origin is proposed in the PAH world hypothesis, whereby polycyclic aromatic hydrocarbons (PAHs) mediate the synthesis of RNA molecules. PAHs are the most common and abundant of the known polyatomic molecules in the visible Universe and are a likely constituent of the primordial sea. PAHs and fullerenes (also implicated in the origin of life) have been detected in nebulae.

The iron-sulfur world theory proposes that simple metabolic processes developed before genetic materials did, and these energy-producing cycles catalyzed the production of genes.

Some of the difficulties of producing the precursors on earth are bypassed by another alternative or complementary theory for their origin, panspermia. It discusses the possibility that the earliest life on this planet was carried here from somewhere else in the galaxy, possibly on meteorites similar to the Murchison meteorite. Sugar molecules, including ribose, have been found in meteorites.Panspermia does not invalidate the concept of an RNA world, but posits that this world or its precursors originated not on Earth but rather another, probably older, planet.

The relative chemical complexity of the nucleotide and the unlikelihood of it spontaneously arising, along with the limited number of combinations possible among four base forms, as well as the need for RNA polymers of some length before seeing enzymatic activity, have led some to reject the RNA world hypothesis in favor of a metabolism-first hypothesis, where the chemistry underlying cellular function arose first, along with the ability to replicate and facilitate this metabolism.

RNA-peptide coevolution

Another proposal is that the dual-molecule system we see today, where a nucleotide-based molecule is needed to synthesize protein, and a peptide-based (protein) molecule is needed to make nucleic acid polymers, represents the original form of life. This theory is called RNA-peptide coevolution, or the Peptide-RNA world, and offers a possible explanation for the rapid evolution of high-quality replication in RNA (since proteins are catalysts), with the disadvantage of having to postulate the coincident formation of two complex molecules, an enzyme (from peptides) and a RNA (from nucleotides). In this Peptide-RNA World scenario, RNA would have contained the instructions for life, while peptides (simple protein enzymes) would have accelerated key chemical reactions to carry out those instructions. The study leaves open the question of exactly how those primitive systems managed to replicate themselves — something neither the RNA World hypothesis nor the Peptide-RNA World theory can yet explain, unless polymerases (enzymes that rapidly assemble the RNA molecule) played a role.

A research project completed in March 2015 by the Sutherland group found that a network of reactions beginning with hydrogen cyanide and hydrogen sulfide, in streams of water irradiated by UV light, could produce the chemical components of proteins and lipids, alongside those of RNA. The researchers used the term "cyanosulfidic" to describe this network of reactions. In November 2017, a team at the Scripps Research Institute identified reactions involving the compound diamidophosphate which could have linked the chemical components into short peptide and lipid chains as well as short RNA-like chains of nucleotides.

Implications

The RNA world hypothesis, if true, has important implications for the definition of life and the origin of life. For most of the time that followed Franklin, Watson and Crick's elucidation of DNA structure in 1953, life was largely defined in terms of DNA and proteins: DNA and proteins seemed the dominant macromolecules in the living cell, with RNA only aiding in creating proteins from the DNA blueprint.

The RNA world hypothesis places RNA at center-stage when life originated. The RNA world hypothesis is supported by the observations that ribosomes are ribozymes: the catalytic site is composed of RNA, and proteins hold no major structural role and are of peripheral functional importance. This was confirmed with the deciphering of the 3-dimensional structure of the ribosome in 2001. Specifically, peptide bond formation, the reaction that binds amino acids together into proteins, is now known to be catalyzed by an adenine residue in the rRNA.

RNAs are known to play roles in other cellular catalytic processes, specifically in the targeting of enzymes to specific RNA sequences. In eukaryotes, the processing of pre-mRNA and RNA editing take place at sites determined by the base pairing between the target RNA and RNA constituents of small nuclear ribonucleoproteins (snRNPs). Such enzyme targeting is also responsible for gene down regulation through RNA interference (RNAi), where an enzyme-associated guide RNA targets specific mRNA for selective destruction. Likewise, in eukaryotes the maintenance of telomeres involves copying of an RNA template that is a constituent part of the telomerase ribonucleoprotein enzyme. Another cellular organelle, the vault, includes a ribonucleoprotein component, although the function of this organelle remains to be elucidated.

Banana

From Wikipedia, the free encyclopedia https://en.wikipedia.org/wiki/Banana Banana Fruits of four differ...