Search This Blog

Sunday, November 28, 2021

Telomere

From Wikipedia, the free encyclopedia

Human chromosomes (grey) capped by telomeres (white)

A telomere (/ˈtɛləmɪər/ or /ˈtləmɪər/, from Ancient Greek: τέλος, romanizedtélos, lit.'end' and Ancient Greek: μέρος, romanizedméros, lit.'part') is a region of repetitive nucleotide sequences associated with specialized proteins at the ends of linear chromosomes. Although there are different architectures, telomeres, in a broad sense, are a widespread genetic feature most commonly found in eukaryotes. In most, if not all species possessing them, they protect the terminal regions of chromosomal DNA from progressive degradation and ensure the integrity of linear chromosomes by preventing DNA repair systems from mistaking the very ends of the DNA strand for a double strand break.

Discovery

In the early 1970s, Soviet theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends; this is called the "end replication problem". Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends.

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph G. Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.

In 1983, Barbara McClintock, an American cytogeneticist and the first woman to receive an unshared Nobel Prize in Physiology or Medicine, received the Nobel Prize for observing that the chromosomes lacking end parts became "sticky" and hypothesized the existence of a special structure at the chromosome tip that would maintain chromosome stability.

Structure and function

End replication problem

Lagging strand during DNA replication.

During DNA-replication, DNA polymerase cannot replicate the sequences present at the 3'-ends. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a primer to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of RNA) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see lagging strand replication). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes) would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated. It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70-100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50-100 base pairs per cell division.

If coding sequences are degraded in this process, potentially vital genetic code would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively degraded in the process of DNA replication.

The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most prokaryotes, relying on circular chromosomes, accordingly do not possess telomeres. A small fraction of bacterial chromosomes (such as those in Streptomyces, Agrobacterium, and Borrelia), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.

Telomere ends and shelterin

Shelterin co-ordinates the T-loop formation of telomeres.

At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1. In many species, the sequence repeats are enriched in guanine, e.g. TTAGGG in vertebrates, which allows the formation of G-quadruplexes, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in ciliates (that possess telomere repeats similar to those found in vertebrates) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes like DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription.

Telomerase

Synthesis of chromosome ends by telomerase

Many organisms have an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap." In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be reactivated and telomeres reset back to an embryonic state by somatic cell nuclear transfer. The steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Length

Telomere length varies greatly between species, from approximately 300 base pairs in yeast to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.

Role in the cell cycle

Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility. If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence), or begin programmed cell self-destruction (apoptosis) depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

Shortening

Oxidative damage

Apart from the end replication problem, in vitro studies have shown that telomeres accumulate damage due to oxidative stress and that oxidative stress-mediated DNA damage has a major influence on telomere shortening in vivo. There is a multitude of ways in which oxidative stress, mediated by reactive oxygen species (ROS), can lead to DNA damage; however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions. Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out; for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for. Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. These results  suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

Association with aging

Telomere shortening is associated with aging, mortality and aging-related diseases. Normal aging is associated with telomere shortening in both humans and mice, and studies on genetically modified animal models suggest causal links between telomere erosion and aging. However, it is not known whether short telomeres are just a symptom of senescence or if they themselves contribute to the progression of the aging process.

The age of a father plays a role in the length of a child’s telomeres, which has evolutionary implications. Although leukocyte telomeres shorten with age, sperm telomeres lengthen with age. Shorter telomeres are theorized to impose lower energy costs (due to less replication) but also have immune system-related and other aging- and disease-related costs, so the effect of paternal age on telomere length might be an adaptation to increase the chances that the child will be fit for the environment they’re born into.

Potential effect of psychological stress

Meta-analyses found that increased perceived psychological stress was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for publication bias. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life.

Lengthening

The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The Hayflick limit is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.

It is becoming apparent that reversing shortening of telomeres through temporary activation of telomerase may be a potent means to slow aging. The reason that this would extend human life is because it would extend the Hayflick limit. Three routes have been proposed to reverse telomere shortening: drugs, gene therapy, or metabolic suppression, so-called torpor/hibernation. So far these ideas have not been proven in humans, but it has been demonstrated that telomere shortening is reversed in hibernation and aging is slowed (Turbill, et al. 2012 & 2013) and that hibernation prolongs life-span (Lyman et al. 1981). It has also been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice and the nematode worm species Caenorhabditis elegans. It has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer (e.g. Weinstein and Ciszek, 2002). However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption.

Elizabeth Blackburn points to studies showing exercise, adequate sleep, and healthy diet correlate with telomere length maintenance in humans, as measured in white blood cells. Genetic predisposition for high telomere maintenance correlates with higher risk for certain types of aggressive cancer (melanoma, glioblastoma, chronic lymphocytic leukemia), pointing to a potential hazard for telomerase-enhancing drugs.

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another unrelated, long-lived seabird species, the great frigatebird (Fregata minor), telomere length did decrease until at least c. 40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

Furthermore, Gomes et al. found, in a study of the comparative biology of mammalian telomeres, that telomere length of different mammalian species correlates inversely, rather than directly, with lifespan, and they concluded that the contribution of telomere length to lifespan remains controversial. Harris et al. found little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities. Gilley and Blackburn tested whether cellular senescence in paramecium is caused by telomere shortening, and found that telomeres were not shortened during senescence.

Sequences

Known, up-to-date telomere nucleotide sequences are listed in Telomerase Database website.

Some known telomere nucleotide sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG
Allium CTCGGTTATGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Research on disease risk

Telomeres are critical for maintaining genomic integrity and may be factors for age-related diseases. Research has found a strong link between shorter length of telomeres and increased risk for some chronic diseases such as type 2 diabetes, cancer, cardiovascular and Alzheimer's disease. During aging process, as the length of telomeres shortens, its function of providing protection to the DNA within our chromosomes depletes which leads to cell aging. Laboratory studies show that telomere dysfunction or shortening is commonly acquired due process of cellular aging and tumor development. Short telomeres can lead to genomic instability, chromosome loss and the formation of non-reciprocal translocations; and telomeres in tumor cells and their precursor lesions are significantly shorter than surrounding normal tissue.

Observational studies have found shortened telomeres in many types of experimental cancers. In addition, people with cancer have been found to possess shorter leukocyte telomeres than healthy controls. Recent meta-analyses suggest 1.4 to 3.0 fold increased risk of cancer for those with the shortest vs. longest telomeres. However, the increase in risk varies by age, sex, tumor type, and differences in lifestyle factors.

Measurement

Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot. A Real-Time PCR assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.

Tools have also been developed to estimate the length of telomere from whole genome sequencing (WGS) experiments. Amongst these are TelSeq, Telomerecat and telomereHunter. Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. Flow-FISH is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006.

While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company, promoted the clinical utility of telomere length measures.

In wildlife

During the last two decades, eco-evolutionary studies have investigated the relevance of life-history traits and environmental conditions on wildlife telomeres. Most of these studies have been conducted in endotherms, i.e. birds and mammals. They have provided evidence for the inheritance of telomere length, however, heritability estimates vary greatly within and among species. Age and telomere length often negatively correlate in vertebrates, but this decline is variable among taxa and linked to the method used for estimating telomere length. In contrast, the available information shows no sex differences in telomere length across vertebrates. Phylogeny and life history traits such as body size or the pace of life can also affect wildlife telomeres, as for example it has been described across bird species. A recent meta-analysis confirms that the exposure to stressors (e.g. pathogen infection, competition, reproductive effort and high activity level) is associated with shorter telomeres across different animal taxa. Telomeres are also a candidate health biomarker for ecotoxicology studies, however, their use still needs further validation as the current literature is taxonomically biased and limited by a reduced number of experimental and longitudinal approaches.

Although ca. 80% of living animals are ectotherms, the knowledge about telomere dynamics in these species is still limited to a few studies in reptiles, fish, and amphibians, whereas invertebrates telomeres have been virtually not explored. Ectotherms are significantly more likely than endotherms to have variation in somatic telomerase expression. For instance, in many fish, telomerase occurs throughout the body (and associated with this, telomere length is roughly the same across all its tissue). Studies on ectotherms, and other non-mammalian organisms, show that there is no single universal model of telomere erosion; rather, there is wide variation in relevant dynamics across Metazoa, and even within smaller taxonomic groups these patterns appear diverse. Due to the different reproductive timelines of some ectotherms, selection on disease is relevant for a much larger fraction of these creatures’ lives than it is for mammals, so early- and late-life telomere length, and their possible links to cancer, seem especially important in these species from a life history theory point of view. Indeed, ectotherms are more sensitive to environmental variation than endotherms and factors like temperature are known to their growth and maturation rates, thus, ectothermic telomeres are predicted to be greatly affected by climate change.

Nanomedicine

From Wikipedia, the free encyclopedia
https://en.wikipedia.org/wiki/Nanomedicine

Nanomedicine is the medical application of nanotechnology. Nanomedicine ranges from the medical applications of nanomaterials and biological devices, to nanoelectronic biosensors, and even possible future applications of molecular nanotechnology such as biological machines. Current problems for nanomedicine involve understanding the issues related to toxicity and environmental impact of nanoscale materials (materials whose structure is on the scale of nanometers, i.e. billionths of a meter).

Functionalities can be added to nanomaterials by interfacing them with biological molecules or structures. The size of nanomaterials is similar to that of most biological molecules and structures; therefore, nanomaterials can be useful for both in vivo and in vitro biomedical research and applications. Thus far, the integration of nanomaterials with biology has led to the development of diagnostic devices, contrast agents, analytical tools, physical therapy applications, and drug delivery vehicles.

Nanomedicine seeks to deliver a valuable set of research tools and clinically useful devices in the near future. The National Nanotechnology Initiative expects new commercial applications in the pharmaceutical industry that may include advanced drug delivery systems, new therapies, and in vivo imaging. Nanomedicine research is receiving funding from the US National Institutes of Health Common Fund program, supporting four nanomedicine development centers.

Nanomedicine sales reached $16 billion in 2015, with a minimum of $3.8 billion in nanotechnology R&D being invested every year. Global funding for emerging nanotechnology increased by 45% per year in recent years, with product sales exceeding $1 trillion in 2013. As the nanomedicine industry continues to grow, it is expected to have a significant impact on the economy.

Drug delivery

Nanoparticles (top), liposomes (middle), and dendrimers (bottom) are some nanomaterials being investigated for use in nanomedicine.

Nanotechnology has provided the possibility of delivering drugs to specific cells using nanoparticles. The overall drug consumption and side-effects may be lowered significantly by depositing the active agent in the morbid region only and in no higher dose than needed. Targeted drug delivery is intended to reduce the side effects of drugs with concomitant decreases in consumption and treatment expenses. Drug delivery focuses on maximizing bioavailability both at specific places in the body and over a period of time. This can potentially be achieved by molecular targeting by nanoengineered devices. A benefit of using nanoscale for medical technologies is that smaller devices are less invasive and can possibly be implanted inside the body, plus biochemical reaction times are much shorter. These devices are faster and more sensitive than typical drug delivery. The efficacy of drug delivery through nanomedicine is largely based upon: a) efficient encapsulation of the drugs, b) successful delivery of drug to the targeted region of the body, and c) successful release of the drug. Several nano-delivery drugs were on the market by 2019.

Drug delivery systems, lipid- or polymer-based nanoparticles, can be designed to improve the pharmacokinetics and biodistribution of the drug. However, the pharmacokinetics and pharmacodynamics of nanomedicine is highly variable among different patients. When designed to avoid the body's defence mechanisms, nanoparticles have beneficial properties that can be used to improve drug delivery. Complex drug delivery mechanisms are being developed, including the ability to get drugs through cell membranes and into cell cytoplasm. Triggered response is one way for drug molecules to be used more efficiently. Drugs are placed in the body and only activate on encountering a particular signal. For example, a drug with poor solubility will be replaced by a drug delivery system where both hydrophilic and hydrophobic environments exist, improving the solubility. Drug delivery systems may also be able to prevent tissue damage through regulated drug release; reduce drug clearance rates; or lower the volume of distribution and reduce the effect on non-target tissue. However, the biodistribution of these nanoparticles is still imperfect due to the complex host's reactions to nano- and microsized materials and the difficulty in targeting specific organs in the body. Nevertheless, a lot of work is still ongoing to optimize and better understand the potential and limitations of nanoparticulate systems. While advancement of research proves that targeting and distribution can be augmented by nanoparticles, the dangers of nanotoxicity become an important next step in further understanding of their medical uses. The toxicity of nanoparticles varies, depending on size, shape, and material. These factors also affect the build-up and organ damage that may occur. Nanoparticles are made to be long-lasting, but this causes them to be trapped within organs, specifically the liver and spleen, as they cannot be broken down or excreted. This build-up of non-biodegradable material has been observed to cause organ damage and inflammation in mice. Magnetic targeted delivery of magnetic nanoparticles to the tumor site under the influence of inhomogeneous stationary magnetic fields may lead to enhanced tumor growth. In order to circumvent the pro-tumorigenic effects, alternating electromagnetic fields should be used.

Nanoparticles are under research for their potential to decrease antibiotic resistance or for various antimicrobial uses. Nanoparticles might also be used to circumvent multidrug resistance (MDR) mechanisms.

Systems under research

Advances in lipid nanotechnology were instrumental in engineering medical nanodevices and novel drug delivery systems, as well as in developing sensing applications. Another system for microRNA delivery under preliminary research is nanoparticles formed by the self-assembly of two different microRNAs deregulated in cancer. One potential application is based on small electromechanical systems, such as nanoelectromechanical systems being investigated for the active release of drugs and sensors for possible cancer treatment with iron nanoparticles or gold shells.

Applications

Some nanotechnology-based drugs that are commercially available or in human clinical trials include:

  • Abraxane, approved by the U.S. Food and Drug Administration (FDA) to treat breast cancer, non-small- cell lung cancer (NSCLC) and pancreatic cancer, is the nanoparticle albumin bound paclitaxel.
  • Doxil was originally approved by the FDA for the use on HIV-related Kaposi's sarcoma. It is now being used to also treat ovarian cancer and multiple myeloma. The drug is encased in liposomes, which helps to extend the life of the drug that is being distributed. Liposomes are self-assembling, spherical, closed colloidal structures that are composed of lipid bilayers that surround an aqueous space. The liposomes also help to increase the functionality and it helps to decrease the damage that the drug does to the heart muscles specifically.
  • Onivyde, liposome encapsulated irinotecan to treat metastatic pancreatic cancer, was approved by FDA in October 2015.
  • Rapamune is a nanocrystal-based drug that was approved by the FDA in 2000 to prevent organ rejection after transplantation. The nanocrystal components allow for increased drug solubility and dissolution rate, leading to improved absorption and high bioavailability.
  • Cabenuva is approved by FDA as cabotegravir extended-release injectable nano-suspension, plus rilpivirine extended-release injectable nano-suspension. It is indicated as a complete regimen for the treatment of HIV-1 infection in adults to replace the current antiretroviral regimen in those who are virologically suppressed (HIV-1 RNA less than 50 copies per mL) on a stable antiretroviral regimen with no history of treatment failure and with no known or suspected resistance to either cabotegravir or rilpivirine. This is the first FDA-approved injectable, complete regimen for HIV-1 infected adults that is administered once a month.

Imaging

In vivo imaging is another area where tools and devices are being developed. Using nanoparticle contrast agents, images such as ultrasound and MRI have a favorable distribution and improved contrast. In cardiovascular imaging, nanoparticles have potential to aid visualization of blood pooling, ischemia, angiogenesis, atherosclerosis, and focal areas where inflammation is present.

The small size of nanoparticles endows them with properties that can be very useful in oncology, particularly in imaging. Quantum dots (nanoparticles with quantum confinement properties, such as size-tunable light emission), when used in conjunction with MRI (magnetic resonance imaging), can produce exceptional images of tumor sites. Nanoparticles of cadmium selenide (quantum dots) glow when exposed to ultraviolet light. When injected, they seep into cancer tumors. The surgeon can see the glowing tumor, and use it as a guide for more accurate tumor removal. These nanoparticles are much brighter than organic dyes and only need one light source for excitation. This means that the use of fluorescent quantum dots could produce a higher contrast image and at a lower cost than today's organic dyes used as contrast media. The downside, however, is that quantum dots are usually made of quite toxic elements, but this concern may be addressed by use of fluorescent dopants.

Tracking movement can help determine how well drugs are being distributed or how substances are metabolized. It is difficult to track a small group of cells throughout the body, so scientists used to dye the cells. These dyes needed to be excited by light of a certain wavelength in order for them to light up. While different color dyes absorb different frequencies of light, there was a need for as many light sources as cells. A way around this problem is with luminescent tags. These tags are quantum dots attached to proteins that penetrate cell membranes. The dots can be random in size, can be made of bio-inert material, and they demonstrate the nanoscale property that color is size-dependent. As a result, sizes are selected so that the frequency of light used to make a group of quantum dots fluoresce is an even multiple of the frequency required to make another group incandesce. Then both groups can be lit with a single light source. They have also found a way to insert nanoparticles into the affected parts of the body so that those parts of the body will glow showing the tumor growth or shrinkage or also organ trouble.

Sensing

Nanotechnology-on-a-chip is one more dimension of lab-on-a-chip technology. Magnetic nanoparticles, bound to a suitable antibody, are used to label specific molecules, structures or microorganisms. In particular silica nanoparticles are inert from the photophysical point of view and might accumulate a large number of dye(s) within the nanoparticle shell. Gold nanoparticles tagged with short segments of DNA can be used for detection of genetic sequence in a sample. Multicolor optical coding for biological assays has been achieved by embedding different-sized quantum dots into polymeric microbeads. Nanopore technology for analysis of nucleic acids converts strings of nucleotides directly into electronic signatures.

Sensor test chips containing thousands of nanowires, able to detect proteins and other biomarkers left behind by cancer cells, could enable the detection and diagnosis of cancer in the early stages from a few drops of a patient's blood. Nanotechnology is helping to advance the use of arthroscopes, which are pencil-sized devices that are used in surgeries with lights and cameras so surgeons can do the surgeries with smaller incisions. The smaller the incisions the faster the healing time which is better for the patients. It is also helping to find a way to make an arthroscope smaller than a strand of hair.

Research on nanoelectronics-based cancer diagnostics could lead to tests that can be done in pharmacies. The results promise to be highly accurate and the product promises to be inexpensive. They could take a very small amount of blood and detect cancer anywhere in the body in about five minutes, with a sensitivity that is a thousand times better a conventional laboratory test. These devices that are built with nanowires to detect cancer proteins; each nanowire detector is primed to be sensitive to a different cancer marker. The biggest advantage of the nanowire detectors is that they could test for anywhere from ten to one hundred similar medical conditions without adding cost to the testing device. Nanotechnology has also helped to personalize oncology for the detection, diagnosis, and treatment of cancer. It is now able to be tailored to each individual's tumor for better performance. They have found ways that they will be able to target a specific part of the body that is being affected by cancer.

Sepsis treatment

In contrast to dialysis, which works on the principle of the size related diffusion of solutes and ultrafiltration of fluid across a semi-permeable membrane, the purification with nanoparticles allows specific targeting of substances. Additionally larger compounds which are commonly not dialyzable can be removed.he purification process is based on functionalized iron oxide or carbon coated metal nanoparticles with ferromagnetic or superparamagnetic properties. Binding agents such as proteins, antibiotics, or synthetic ligands are covalently linked to the particle surface. These binding agents are able to interact with target species forming an agglomerate. Applying an external magnetic field gradient allows exerting a force on the nanoparticles. Hence the particles can be separated from the bulk fluid, thereby cleaning it from the contaminants.

The small size (< 100 nm) and large surface area of functionalized nanomagnets leads to advantageous properties compared to hemoperfusion, which is a clinically used technique for the purification of blood and is based on surface adsorption. These advantages are high loading and accessible for binding agents, high selectivity towards the target compound, fast diffusion, small hydrodynamic resistance, and low dosage.

Tissue engineering

Nanotechnology may be used as part of tissue engineering to help reproduce or repair or reshape damaged tissue using suitable nanomaterial-based scaffolds and growth factors. Tissue engineering if successful may replace conventional treatments like organ transplants or artificial implants. Nanoparticles such as graphene, carbon nanotubes, molybdenum disulfide and tungsten disulfide are being used as reinforcing agents to fabricate mechanically strong biodegradable polymeric nanocomposites for bone tissue engineering applications. The addition of these nanoparticles in the polymer matrix at low concentrations (~0.2 weight %) leads to significant improvements in the compressive and flexural mechanical properties of polymeric nanocomposites. Potentially, these nanocomposites may be used as a novel, mechanically strong, light weight composite as bone implants.

For example, a flesh welder was demonstrated to fuse two pieces of chicken meat into a single piece using a suspension of gold-coated nanoshells activated by an infrared laser. This could be used to weld arteries during surgery. Another example is nanonephrology, the use of nanomedicine on the kidney.

Medical devices

Neuro-electronic interfacing is a visionary goal dealing with the construction of nanodevices that will permit computers to be joined and linked to the nervous system. This idea requires the building of a molecular structure that will permit control and detection of nerve impulses by an external computer. A refuelable strategy implies energy is refilled continuously or periodically with external sonic, chemical, tethered, magnetic, or biological electrical sources, while a non-refuelable strategy implies that all power is drawn from internal energy storage which would stop when all energy is drained. A nanoscale enzymatic biofuel cell for self-powered nanodevices have been developed that uses glucose from biofluids including human blood and watermelons. One limitation to this innovation is the fact that electrical interference or leakage or overheating from power consumption is possible. The wiring of the structure is extremely difficult because they must be positioned precisely in the nervous system. The structures that will provide the interface must also be compatible with the body's immune system.

Cell repair machines

Molecular nanotechnology is a speculative subfield of nanotechnology regarding the possibility of engineering molecular assemblers, machines which could re-order matter at a molecular or atomic scale.[citation needed] Nanomedicine would make use of these nanorobots, introduced into the body, to repair or detect damages and infections. Molecular nanotechnology is highly theoretical, seeking to anticipate what inventions nanotechnology might yield and to propose an agenda for future inquiry. The proposed elements of molecular nanotechnology, such as molecular assemblers and nanorobots are far beyond current capabilities. Future advances in nanomedicine could give rise to life extension through the repair of many processes thought to be responsible for aging. K. Eric Drexler, one of the founders of nanotechnology, postulated cell repair machines, including ones operating within cells and utilizing as yet hypothetical molecular machines, in his 1986 book Engines of Creation, with the first technical discussion of medical nanorobots by Robert Freitas appearing in 1999. Raymond Kurzweil, a futurist and transhumanist, stated in his book The Singularity Is Near that he believes that advanced medical nanorobotics could completely remedy the effects of aging by 2030. According to Richard Feynman, it was his former graduate student and collaborator Albert Hibbs who originally suggested to him (circa 1959) the idea of a medical use for Feynman's theoretical micromachines (see nanotechnology). Hibbs suggested that certain repair machines might one day be reduced in size to the point that it would, in theory, be possible to (as Feynman put it) "swallow the doctor". The idea was incorporated into Feynman's 1959 essay There's Plenty of Room at the Bottom.

Rejuvenation

From Wikipedia, the free encyclopedia
https://en.wikipedia.org/wiki/Rejuvenation

Rejuvenation is a medical discipline focused on the practical reversal of the aging process.

Rejuvenation is distinct from life extension. Life extension strategies often study the causes of aging and try to oppose those causes in order to slow aging. Rejuvenation is the reversal of aging and thus requires a different strategy, namely repair of the damage that is associated with aging or replacement of damaged tissue with new tissue. Rejuvenation can be a means of life extension, but most life extension strategies do not involve rejuvenation.

Historical and cultural background

Various myths tell the stories about the quest for rejuvenation. It was believed that magic or intervention of a supernatural power can bring back youth and many mythical adventurers set out on a journey to do that, for themselves, their relatives or some authority that sent them anonymously.

An ancient Chinese emperor actually sent out ships of young men and women to find a pearl that would rejuvenate him. This led to a myth among modern Chinese that Japan was founded by these people.

In some religions, people were to be rejuvenated after death prior to placing them in heaven.

The stories continued well into the 16th century. The Spanish explorer Juan Ponce de León led an expedition around the Caribbean islands and into Florida to find the Fountain of Youth. Led by the rumors, the expedition continued the search and many perished. The Fountain was nowhere to be found as locals were unaware of its exact location.

Since the emergence of philosophy, sages and self-proclaimed wizards always made enormous efforts to find the secret of youth, both for themselves and for their noble patrons and sponsors. It was widely believed that some potions may restore the youth.

Another commonly cited approach was attempting to transfer the essence of youth from young people to old. Some examples of this approach were sleeping with virgins or children (sometimes literally sleeping, not necessarily having sex).

The quest for rejuvenation reached its height with alchemy. All around Europe, and also beyond, alchemists were looking for the Philosopher's Stone, the mythical substance that, as it was believed, could not only turn lead into gold, but also prolong life and restore youth. Although the set goal was not achieved, alchemy paved the way to the scientific method and so to the medical advances of today.

Serge Abrahamovitch Voronoff was a French surgeon born in Russia who gained fame for his technique of grafting monkey testicle tissue on to the testicles of men while working in France in the 1920s and 1930s. This was one of the first medically accepted rejuvenation therapies (before he was proved to be wrong around 1930–1940). The technique brought him a great deal of money, although he was already independently wealthy. As his work fell out of favor, he went from being a highly respected surgeon to a subject of ridicule. By the early 1930s, over 500 men had been treated in France by his rejuvenation technique, and thousands more around the world, such as in a special clinic set up in Algiers. Noteworthy people who had the surgery included Harold McCormick, chairman of the board of International Harvester Company, and the aging premier of Turkey.

Swiss doctor Paul Niehans, who was one of the fathers of cellular therapy, developed in 1931–1949 years the so-called Fresh cell therapy. Fresh cell therapy is mainly the use of live animal embryo organs cells which are injected into the patient with the purpose of achieving a revitalizing effect. These cells are generally extracted from sheep’s fetuses because in comparison to other animals, like pigs, rabbits and cows, sheep are clean animals and rarely contract diseases. Of course animal cells are not able to be included in human tissue, but they can secrete factors for rejuvenating. That's why this rejuvenation technology, despite the harsh criticism is practiced to this day.

Rejuvenation technology and its effects on individuals and society have long been a subject of science fiction. The Misspent Youth and Commonwealth Saga by Peter F. Hamilton are among the most well known examples of this, dealing with the short- and long-term effects of a near perfect 80-year-old to 20-year-old body change with mind intact. The less perfect rejuvenation featured in the Mars trilogy by Kim Stanley Robinson results in long-term memory loss and sheer boredom that comes with extreme age. The post-mortal characters in the Revelation Space series have long-term or essentially infinite lifespans, and sheer boredom induces them to undertake activities of extreme risk.

Modern developments

Aging is an accumulation of damage to macromolecules, cells, tissues and organs. If any of that damage can be repaired, the result is rejuvenation.

There have been many experiments which have been shown to increase the maximum life span of laboratory animals, thereby achieving life extension. A few experimental methods such as replacing hormones to youthful levels have had considerable success in partially rejuvenating laboratory animals and humans. A recent experiment involved breeding genetically manipulated mice that lacked an enzyme called telomerase, causing the mice to age prematurely and suffer ailments. When the mice were given injections to reactivate the enzyme, it repaired the damaged tissues and reversed the signs of aging. There are at least eight important hormones that decline with age: 1. human growth hormone (HGH); 2. the sexual hormones: testosterone or oestrogen/progesterone; 3. erythropoietin (EPO); 4. insulin; 5. DHEA; 6. melatonin; 7. thyroid; 8. pregnenolone. In theory, if all or some of these hormones are replaced, the body will respond to them as it did when it was younger, thus repairing and restoring many body functions. In line with this, recent experiments show that heterochronic parabiosis, i.e. connecting the circulatory systems of young and old animal, leads to the rejuvenation of the old animal, including restoration of proper stem cell function. Similar experiments show that grafting old muscles into young hosts leads to their complete restoration, whereas grafting young muscles into old hosts does not. These experiments show that aging is mediated by systemic environment, rather than being an intrinsic cell property. Clinical trials based on transfusion of young blood were scheduled to begin in 2014. Another intervention that is gaining popularity is epigenetic reprogramming. Through the use of Yamanaka factors, aged cells can revert to a younger state.

Most attempts at genetic repair have traditionally involved the use of a retrovirus to insert a new gene into a random position on a chromosome. But by attaching zinc fingers (which determine where transcription factors bind) to endonucleases (which break DNA strands), homologous recombination can be induced to correct and replace defective (or undesired) DNA sequences. The first applications of this technology are to isolate stem cells from the bone marrow of patients having blood disease mutations, to correct those mutations in laboratory dishes using zinc finger endonucleases and to transplant the stem cells back into the patients.

Enhanced DNA repair has been proposed as a potential rejuvenation strategy.

Stem cell regenerative medicine uses three different strategies:

  1. Implantation of stem cells from culture into an existing tissue structure
  2. Implantation of stem cells into a tissue scaffold that guides restoration
  3. Induction of residual cells of a tissue structure to regenerate the necessary body part

A salamander can not only regenerate a limb, but can regenerate the lens or retina of an eye and can regenerate an intestine. For regeneration the salamander tissues form a blastema by de-differentiation of mesenchymal cells, and the blastema functions as a self-organizing system to regenerate the limb.

Yet another option involves cosmetic changes to the individual to create the appearance of youth. These are generally superficial and do little to make the person healthier or live longer, but the real improvement in a person's appearance may elevate their mood and have positive side effects normally correlated with happiness. Cosmetic surgery is a large industry offering treatments such as removal of wrinkles ("face lift"), removal of extra fat (liposuction) and reshaping or augmentation of various body parts (abdomen, breasts, face).

There are also, as commonly found throughout history, many fake rejuvenation products that have been shown to be ineffective. Chief among these are powders, sprays, gels, and homeopathic substances that claim to contain growth hormones. Authentic growth hormones are only effective when injected, mainly due to the fact that the 191-amino acid protein is too large to be absorbed through the mucous membranes, and would be broken up in the stomach if swallowed.

The Mprize scientific competition is under way to deliver on the mission of extending healthy human life. It directly accelerates the development of revolutionary new life extension therapies by awarding two cash prizes: one to the research team that breaks the world record for the oldest-ever mouse; and one to the team that develops the most successful late-onset rejuvenation. Current Mprize winner for rejuvenation is Steven Spindler. Caloric restriction (CR), the consumption of fewer calories while avoiding malnutrition, was applied as a robust method of decelerating aging and the development of age-related diseases.

Strategies for engineered negligible senescence

The biomedical gerontologist Aubrey de Grey has initiated a project, strategies for engineered negligible senescence (SENS), to study how to reverse the damage caused by aging. He has proposed seven strategies for what he calls the seven deadly sins of aging:

  1. Cell loss can be repaired (reversed) just by suitable exercise in the case of muscle. For other tissues it needs various growth factors to stimulate cell division, or in some cases it needs stem cells.
  2. Senescent cells can be removed by activating the immune system against them. Or they can be destroyed by gene therapy to introduce "suicide genes" that only kill senescent cells.
  3. Protein cross-linking can largely be reversed by drugs that break the links. But to break some of the cross-links we may need to develop enzymatic methods.
  4. Extracellular garbage (like amyloid) can be eliminated by vaccination that gets immune cells to "eat" the garbage.
  5. For intracellular junk we need to introduce new enzymes, possibly enzymes from soil bacteria, that can degrade the junk (lipofuscin) that our own natural enzymes cannot degrade.
  6. For mitochondrial mutations the plan is not to repair them but to prevent harm from the mutations by putting suitably modified copies of the mitochondrial genes into the cell nucleus by gene therapy. The mitochondrial DNA experiences a high degree of mutagenic damage because most free radicals are generated in the mitochondria. A copy of the mitochondrial DNA located in the nucleus will be better protected from free radicals, and there will be better DNA repair when damage occurs. All mitochondrial proteins would then be imported into the mitochondria.
  7. For cancer (the most lethal consequence of mutations) the strategy is to use gene therapy to delete the genes for telomerase and to eliminate telomerase-independent mechanisms of turning normal cells into "immortal" cancer cells. To compensate for the loss of telomerase in stem cells we would introduce new stem cells every decade or so.

In 2009, Aubrey de Grey co-founded the SENS Foundation to expedite progress in the above-listed areas.

Scientific journal

 

Near-infrared spectroscopy

From Wikipedia, the free encyclopedia https://en.wikipedia.org/wiki/Near-infrared_spectroscopy   ...